GenePrediction:GLEAN_5188 Details

Name: GLEAN_5188
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1301717..1300542 (- strand)
Length: 1176
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1301717..1301601 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_97:1301541..1301410 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_97:1301345..1300542 (- strand)
Length: 804
>GLEAN_5188 class=GenePrediction position=GCSC_97:1301717..1300542 (- strand)
ATGCCGGCCTTTAACACCTCGATTGCATTGACGTCTGCGGCCGTTGTGGGCTCGAGCGCGATTGTCGGCTCGGCCATGGG
GTGGTGGACCAAGAACCAGATGCCGGTCGAGGGCAAGGTGAGCGAGCGAGGAGTGAGGATGGAGGCGAGTGACTGACGAC
GGCTGACACTCGACAGACGGTGCTTCTGACGGGAGCGACCGAGGGCATGGGCCGGTCTGTGGCCAAGCAGCTGGCGGCCC
AGGGCGCGGACGTGATTGTGGTGGCGCGCAATGTCGGACGTCTGGCCGAGACGGTAGCAGAGCTAAAGGTTTGTTGCGTG
GAGACTTTGCGTCTTGTCTGCTCGTCTGTTCTTCTCTCGCTAATCTGCCCAGACGCTCGCCCCGTCCGAGTCGCAGCGGT
TCCACCACATCGCGGCCGACGTGGCCGAGCCCAACTACGCGGCAGCCGTGATCGCGGACGCGCTCGCCTGGAACGGAGGC
CGGCCGATCGACGTGGTCTGGTGTGTGGCCGGCATGTCGACGCCGATGCTGTGGGCCGAGGAGCCGCAGGCGGTGGCGCT
GGGGGCCAGCCGGCGCAACATGGACGTCAACTTCTGGGGCGCGGCCGAGATGGCGCACGCGATCCTGCGCGAGTGGCTGC
GACCCGAGGCCGGACCGTATGCCGAGCCGCGTCATCTCGTCCTCACGGCCTCGGTGCTGGCCTTTTTTGCCGTCGTCGGC
TACGCGCCCTACACGCCGACCAAGTGGGCGCTCCGCGGCCTCGCCGACACGCTCGCCCAGGAGACCCTGCTCTACTACGA
TACCAACCCGGTCCGCGTCTCGGTCGTCTTCCCCGGCACCATCCTCAGCCCCGGGCTCGCGCGTGAGAACACGACCAAGC
CCGACGTCACCCTCCAGCTCGAAAAGGACGACCCCCAGCTGTCGCCCGATCAGGTCGCCGCTCAGGCCATTCGCGGCCTC
CAGCGCGGCCACCACTTCGTCACCGTCTCCTGGCTCGGCGACCTCATGCGCTGGGGCACCCTCGGCGGCGCCCCCCGCAA
CAGCTGGCTGTGCGATACCCTCGGCGCCTACCTCGTCGCCTTTGTCATGTTCTTCGTCGTCTGGTGGATCCACGGCGATA
TCCGCGCCTACGCTCGCAAGCACGGCCACCCGGCCACGTACGCGAAGAAGGGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62