GenePrediction:GLEAN_5189 Details

Name: GLEAN_5189
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1295688..1295349 (- strand)
Length: 340
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1295688..1295611 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:1295543..1295349 (- strand)
Length: 195
>GLEAN_5189 class=GenePrediction position=GCSC_97:1295688..1295349 (- strand)
ATGTCTGACTCTTCCGCCCCGGCACCAGTACGGAGCGTGGTTTCGCGGCCCGTCAGCGAGGCCCTGCTGAACGAGAAGGT
GTGACCATTCTGCTTGCACAAGCTTCGTAATGTCAGAGACCACTCACTAAATTGATGCCGCGCAGTGGGACCACTGCCTG
TCCAACCTGGTCATCAAGTCGGCTCTCGGCCTCGGCTTCGGCGTCGTCTTCTCCGTCCTTCTCTTCAAGCGGAGAACCTG
GCCGGCCGTCATCGGCGTCGGCTTCGGCGCCGGCCGCGCCTACGAGGAGTGCAACTCGGCCCTCAAGCAGGCCGCCAAGG
ACATCCGGAAGACCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62