GenePrediction:GLEAN_518 Details

Name: GLEAN_518
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:313117..314458 (+ strand)
Length: 1342
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:313117..313863 (+ strand)
Length: 747
Type: CDS
Source: GLEAN
Position: GCSC_97:313934..314458 (+ strand)
Length: 525
>GLEAN_518 class=GenePrediction position=GCSC_97:313117..314458 (+ strand)
ATGTACCCCCTCCGCTCGCTGCTGCTGGCAGGCCTCTGCCTGTGCGCCCAGGTGTCTGCTGCTCCCCTCGTGAAGCGCGG
GTCCTCGGCAATCACCCTCACGGAGCCAATTGCCCCCCGTGACGATCCGTGGTACTCGGAACCCGATGGCTTCGAGAACG
ACGCTCCCGGCACCATTCTGCGCATCCGCAAGGCCCCGGGCAACCTGACGACCATCACCACCAACTGCTCGGCCGCCTAC
AACATCCTCTACCGCACCACCAACAGTCTGTACAAGCCGACGTGGGCTGTAACCACGCTGTTCGTTCCCAAGAACCACAC
CGATGCCCTGCTGTCGTACCAAATCCCCTACGACACCGCCGACCTCAATGCCAGCCCCAGCTACGCCCTGTACTCGAATA
CACCTACCGACGTGACCGCCTCGCTGGGCAAAGGCTGGTTCGTCAACGTGCCGGACTATGAGGGCCCCCTAGCCAGCTTC
ACCGCTGGCGTCCTGTCTGGTCATGCCACCATTGACGCTGTCCGCGCCGTGCTTTCAGCTAAGGAATGCCTCAAACTTCC
TGACGGGCTGAAATACGCCCTGTGGGGATACTCTGGTGGTGCTCTCGCCAGCGAGTGGGCGGCTGAGCTGCAGGTTCAAT
ACGCCCCCGAGCTAACCTTTAGCGGCGTGGCCCTAGGCGGTCTTACGCCCAACATCACCAGCGTCCTGACGACGATCAAC
AACAAGCTCATGGCCGGTCTGGCAGTGGTGAGTAGCTTCCTGAGGGGCCGGTCTAGCCGTCCGCATTCGGTAAAGGCTAA
CAAAAGTTCGCCTGCAGTCTTCCATCATTGGCACGTGCAACCAATACCCTGAGATTATGGCAATGCTCGAGTCCAAGCTC
AAGCCGACTGGCGATCTCAACAGCACCAGCTTTCTGGCGGCCCAGAACATGACCCTGACCGAGACTCTTGTGGCTTTCGC
CGGCAAGAACATCTCTGCCTTCTTTGTCGATGGCGAGATGGACATCCTTAACCCGATTACCGACAAGCTCATTAGCAAGG
ACGGAATCATGGGCTACCACGGCGTCCCGCAGGCCCCCATCTTCGCGTACAAGGCTGTTGAGGATGAGGTCAGCCCCATC
GCTGACACCGACAAGCTGGTCACGTCATACTGCGCCATGGGTGCCAACATCTTGTACCAGAGAAACAGCATTGGCGGTCA
TTCGGCCGAGCAGACCAACGGCCGTGCAGCTGCTTCTGCTTGGCTGGACAGCGTTCTGGGGGGCACCTATTCGAAGACGT
ACAACACGACTGGCTGCACAATCCAGGATGTGGCCCTGAATGTCACATCCTCGCCCTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62