GenePrediction:GLEAN_5190 Details

Name: GLEAN_5190
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1289880..1288626 (- strand)
Length: 1255
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1289880..1289763 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_97:1289692..1289350 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_97:1289287..1288731 (- strand)
Length: 557
Type: CDS
Source: GLEAN
Position: GCSC_97:1288669..1288626 (- strand)
Length: 44
>GLEAN_5190 class=GenePrediction position=GCSC_97:1289880..1288626 (- strand)
ATGGGTTGTGGATTGAGCGTGGAGGAGAAGGAGGGCAAGGCCCGGAACGAGGAGATTGAGAACCAGCTGAAGCGCGACCG
CATGCAACAACGAAATGAGATCAAGATGCTCCTTCTGGGTACGTTGCTCCGCCTGAACCGAGTCATTGTCACGAATCGCT
TTGGCAGAGTGCTGACTCGTCGCTACAGGTGCTGGTGAATCCGGAAAGTCGACCATCTTGAAGCAGATGAAGCTCATTCA
CGAGGGCGGATACTCGCGCGACGAGCGGGAATCGTTCAAAGAAATCATCTACAGCAATACCGTACAGTCGATGCGCGTCA
TCCTCGAGGCCATGGAGTCGCTAGAGCTCCCCTTGGAGGACCAGCGGATGGAGTACCATGTGCAGACCATCTTCATGCAG
CCGGCTCAGATTGAAGGTGAGGTCCTGCCGCCTGAGGTTGGCAATGCCATTGAGGCGTTGTGGAAGGATCGCGGTGTTCA
GGACTGCTTCAAGCGGTCACGCGAGTACCAGTTGAACGACTCCGCCCGATAGTAAGTTGCCCGTCGCAAAGCGCTTGCCA
CTGTATGTCCTAGCCACTTACCTATGCCGTTAGCTACTTTGACAACATCACTCGCATCGCCGCGCCCGATTACATGCCCG
ACGACCAAGACGTGCTGCGATCGCGTGTCAAGACCACCGGTATCACCGAGACGACATTTATTATCGGCGACCTGACATAT
CGTATGTTCGACGTCGGTGGCCAGCGGTCCGAACGGAAGAAGTGGATCCATTGTTTTGAGAACGTCACAACGATTCTCTT
CCTGGTCGCTATTTCCGAGTACGACCAGCTTCTGTTCGAGGACGAGACAGTCAACCGTATGCAGGAAGCCCTGACGCTGT
TCGACTCCATCTGCAACTCGCGGTGGTTTGTCCGGACATCCATCATTCTTTTCCTCAACAAGATTGATCGGTTCAAGGAG
AAGCTTCCAGTCAGCCCGATGAAGAACTACTTCCCCGACTACGAGGGTGGTGATGACTACGCGGCTGCCTGCGATTACAT
CCTCAACCGCTTCGTCAACCTGAACCAGCACGAGTCCAAGCAGATCTACACCCATTTTACTTGCGCCACAGACACGACGC
AGATCCGCTTCGTCATGGCCGCTGTCAATGGTATGTCGCCTGCCCGTCGTCGATGGTGTTGCGTGCGAACCCGATACTGA
CATTGCGCTAGATATCATCATCCAGGAAAACCTGCGGCTTTGTGGTCTGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62