GenePrediction:GLEAN_520 Details

Name: GLEAN_520
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:327164..329773 (+ strand)
Length: 2610
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:327164..327833 (+ strand)
Length: 670
Type: CDS
Source: GLEAN
Position: GCSC_97:327977..329634 (+ strand)
Length: 1658
Type: CDS
Source: GLEAN
Position: GCSC_97:329693..329773 (+ strand)
Length: 81
>GLEAN_520 class=GenePrediction position=GCSC_97:327164..329773 (+ strand)
ATGCGCTTCGGCAAGACTCTCCGCGAGTCGGTCTATCCTCCGTGGAAAGACGCGTACATCGACTACACCAAGCTGAAACG
GCTGCTCCGCGATGACGAGGACGAGGGATCCGACGCCGAGGGCGGCGAGATGAGCTGGACCGACGAGGACGAGAACCGCT
TCTGCGACGAGATCTTCAACGGGCAGCTCGAGAAGGTGGCCCGCTTTCAGGAGAGCCAGTCGAATGCGCTGCGCGAGCGG
ACCGACGCGGCGTTTGAGAAGCTCAAGGACCTGACGCCGGCCAGCGACGAGACCACGGCCGAGGCCGAGGGAGAGGCGAA
GAGCGAGATCGCGCTGCAGCGGGTGCGGGCGATCGAGACGGAGCTGGACAGCATCACCAACGAGATCCGTGAGCTCAAGC
GCTACAGCGGGCTCAACTACACCGGCTTCCTCAAGATTGCCAAGAAGCACGATCGCAAGCGCGGCAACCACTACCGGATC
CGGCCGATGATGCAGGTCAGCCTGACGCGGCGGCCGTTCAACTCGGAGGCAGGCTACTCGCCGCTGCTGGCCAAGCTGTC
GCTCATGTACGAGGCAGTGCACCAGTACCTGAACCCGGAGGAGACACATCCGATCGACCTGGAGACGCCGCAGGAGAAGG
TCAACGGGGGAGTGTACACGGCACACAAGTGTAGGTTTTCAGGGCGTCTTGGAAATTTTTTTTTTTTTCTTTTCCTTCTT
TTTTTTTCTTTTTTTTTTCTTTTTTTTTTTCTTTCTTCCTTTCCTCCTTCCCTTTCTCCTTCCCTTTCTCCTTCCGTTCT
AACCAACTTACAGACTGGGTCCATCCCGATAACCTGCTCGAGGTCAAGACAATGGTGCTGCGCCACCTGCCGGCACTGGT
GTATAGCGACTCATCGGCCAAAGAAGCTGATGCCACGGCAGACCCGACGGTGACGTCGCTATACTTTGACAACAGCAAGT
TTGAGCTGTACAACAACAAGCTGGAGCCGAGCGGGGACGCGACGTCGCTGCGGCTGCGGTGGTACGGGCAACTAGCGACG
AAGCCGGAGATCTTCCTGGACGAGAAGGTGGTGCGCAAGGACGGGACGAGCGAGGAGCACCGGATCCCGATCAAGGACAA
GTACATCCAGCTGTTCCTGGAGGGAAAGTACGGCATGGAGAAGAGCATGCAGAAGATGGAGCGGCAGGGCGAGCGGCCGG
CCGAGGTGGCAGCGTTCCGTCAGACGGCCGAGGCGATCCAGGCGTTGGTGAGCCAGAAGCATCTGGAACCTGTGCTGCGG
GCCAACTACGTGCGGACGGCGTTTCAAAAGCCAGCCGACGACCGGGTGCGCGTGTCCATCGACACATCGCTGGCCTTTAT
CCGCGAGGACAACCTAGACCGTGGGCGGCCGTGTCGTGATGCGGCCGAATGGCATCGCCGCGATATTGACGCCGGCACGG
TGACGTATCCGTTTGGCGATCTGCCGCCGAGCGACGTCTCACGCTTCCCCTTTGCCGTGCTGGAGATCAAGCTGCGCGAG
GGCGAGAGTGCGCGCAAGCAGCGGCCGGCCTGGGTCGAGGACCTGATGGCCTCGCATCTATTGCACGCGGCGCCGCACTT
TAGCAAGTTTGTGCACGGCGCGGCCGTGTTGTTTGACGACTACGTGAACCGCTTGCCGTTCTGGATCGGCGACCTGGAGC
GCGACATCCGCCGCGACCCACAGGAGGCGTTTGCCGAGGAGGAGCTGCGGCGGGCGCAGCGGGCGGCCGACGAACAGGCA
GTCGGCAGCTTGCTGGGCACGACGGGCAAGCAGGGCTCGTACAAGCCGATGCGGAGCTCGCCGGCCGTCAAGTCGGCGTC
GTACCTGGCGGACAAGCTGGCGGCCGAGGCATCGATCGCGAAGCGGGTGGCGGTGCGTGGAGGGACTGGGGGGACTGGGG
GGACTGGGGGGACTGGGGGGACTGGGGGGGCTGGCGAGAATGGGGAGTCGGCAGTCAGCGAGATCCCCGGTGCCAACGAG
TCGCATGCACCCACTGCATCGTACGGCACCATCTCGTCGGTCCTCCCATCCTTCTCGATGACGCGCTACGCCAGCTGGCA
CCGGGCCAAGGACCGTGGCCCCGAGCTGCCCGAGGGCGTGAGGGAGCCGACGGAGTGGCTGAAGAACGCGGGACCGCTAC
GGATTGAGCCCAAGGTCTGGCTCGCTAACGAGCGCACGTTTCTCAAGTGGCAGCACATCTCGATTCTGCTGGGCAGTCTG
GCCGTCGCGCTCTTCACGGCCGCCGGCAGCGGCAGCAGCGGCAGCCAGGCCGTGGCCATGAGCATGGGCGTGGCATACGT
CACCGCGGCCGCCTTTGCCGGCTTCTGGGGGTCGTACATGCTGCACACGCGGCGTGAGATGATCGTGGCGCGCAGCGGCC
GTGATTTTGACAACATGGTCGGGCCGGTCGTCGTAACGGTGGCGCTGGTCGTGGCGCTGGTGCTCAACTTTGTGTTTGCA
GTAAGTGTGTGTGTGTGTGTGTGTTGCATTCGGATGCTAACATTAACAGTACCGTGCTGCCTTCAAGAGATGGGCCGACA
ACGCGACACTTCTGGACACCAACACCACTATGGCTTATACACATATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62