GenePrediction:GLEAN_5214 Details

Name: GLEAN_5214
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1154673..1151698 (- strand)
Length: 2976
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1154673..1154543 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_97:1154488..1154395 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_97:1154310..1154062 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_97:1153998..1151698 (- strand)
Length: 2301
>GLEAN_5214 class=GenePrediction position=GCSC_97:1154673..1151698 (- strand)
ATGGCCAACCTCACGGGAACACCATCCGGCAACCATTTGCCAGGCGTGCGGACGAACTCAGAGAAGAAGCTCGGTGTCTT
GCACTACACATCCTGCATCGACTTTGGTTGGATTGGAGACATTCGCAAGCGGTAAGTCTCAGTCTGCATTCGTTCTTACC
ACTACATTGCTAACCCCAGTCTCAGCTATACTGATTTTATTGTCCACGAAGTTCGAAAGGATGGCACCGTCGTCTATCTT
TCTGACGTCGTGGAAATGGACCCGGAAAAGCTGCGCGCTGTAAGTGGCCTTGAGACCGAGATACGAGAGTGCATACGTCC
TCGACATCCAGATCAAAGCATGAATCTAACAAAAATCTGACAGGAACCTGAGAAGACTGAACGGGTAGCTTTAATTGAGC
ATAAGCATGTTCCCGAATCGAAGACAGAAGAACCAGAAGCGGCCGAGATCTCGAAAGAAGACGCCGATGCACTCAGCATT
CTGCTGGGTGCCGAGGCAGCAAAGGAGCTCCAGGAAATGTACGCGGCCATTGTTGCTGGCGGGGTGGACCGAAATGCAAA
GGTCACTTTTGCCGTCAGCTCTGACCGCAGCCAACGCGGTCACATTCACCAGGTATACCTCCTCCTGTCTGTGACAGGGC
TCGTCTTTCATGTTTTCCGCGATTAACGTTCTTAGGAAATCCGGCGCATCTTCTTCGGTCGCTTCGAAACACAAGCGGAC
CCCAACAGCGGGTCCATTTCGGCGCAGCCGGTGTCTGGCCGTGGAAAACCGCGGGTCCCTCGCCGCAACCTTAATGGGCC
CAACTGGCGCGAGAACCGGGACAGCCGCGACAGCCGGGACAACCAGGGGCGCAACGCTGGCGGTCCCAACCCGCCGCGCA
AGGGGCCGTACCTCCATTTCACTCTCTACAAGGAGAACAAGGATACAATGGAGGCAATCAACCACCTTGCGCGGATGATG
AAGATGAAGTCGGTCAACTTCGGCTTCGCGGGCACCAAGGATCGCCGTGCTGCTACCACCCAGCGTGTTAGTGTTAAGTA
CCATGGCCACGTTGATCCTGCCTGGCTGAACTCGCGCAACAACAACATCAAGGTCGGGGATTTCAGCTACCACAAAGCGC
CTATCCAGCTTGGCCAACATGGCGGTAATGAGTTCACCATTGCTATCAAGAACGTTGAGCTGGCGCGGGGGAAGAACTGC
TCCTTGAGTCACCGCCTCCGGATGGCCGAGTCTTGCGTCCAGGCTGCGCTCGATCACATCCAGCAAAATGGCTTCATCAA
CTACTTTGGTCTTCAGCGCTTCGGCACCCACGCCATTGGGACCCAGGAGGTCGGCCTGAAGATTCTCAGCGGAGACTTCG
AGTCGGCCTGCGACTACATCCTTCACGTGGATCCTGCACTGATGGCACGCCTAAACGATCCCGATGTCGAGCTTGCGTTC
CAGCGGGATGAGATCAGCCGCGCCCGGGCCATCAGCCTGTTCAAGACCAATGGCGATACTGGTCCTGCTCTTCAAACCCT
ACCAAAACGTTACGGTGCCGAATCGGCCATTCTCCAACATCTGAGTCGCAGCCTTGCATCGCGCCGCGACTTTTGCGGTG
CTCTTCTCAAGATCACTCGCGGCCTGCGCAATCTCTACATCCATGCGTACCAATCGCTCGTGTGGAATTGGATAGTCAGT
CGACGCTGGTCCAAGTTTGGCAACACGGTCATCGCCGGAGACCTGGTGCTTGTCGAGTCCGAAGTGAACCCTGCTCGGTA
CCGTTCGGGCATGGACATGTCAGAAGATCTGAACCAGGATGAAGAGCAATTTTACCAGGAAGCTCGTGTGCTGACCGCCG
AGGATGCAGCCAGCGGCAAGTACACAATCTTTGACATTGTGCTTCCTGTGCCTGGCTACGACGTTCTGTACCCAGAGAAT
GAGATTGGCGAATTCTACGTCGAGTTCATGGGCCGACCGGAAAACGGTGGGCTGAACCCATACCGGATGCGCCGCCCACA
GAAGGAGTTCAGTCTCAGCGGCTACTACCGGAAGATCATGGCGCGCTTTTCGACTGTTCCCAAGTTTTTCGTCCGTCCGT
ACATGGACGATTCCGAGCAGATGCACCCAACTGATCTCGATGAAATCAGACTACGTAAGGCTGGAGAGGGTCAGAAGCAG
GCGGGTTCGCTTGCTCCTGTTGCGGAATCGACCAGCACCAGCGATAACACCGAAACCGGTGATATAGCGGACTCAACTAC
CATCCAGGATGAGACGAGCCGTCGCCGTCGTTTGACGCCTGACCGACCACAAGATCCTCCCGAAAAACGTGTTAATGACG
CGTGGATCGAGACCAAGTTGGACGGTAGCAGCAAGCGTGTCAAGCTGGAAGTCGCACAAGCAGTCGATGAGAACGTTGCT
CCAGCAGGGGAACCCGTCTCCACCAAACCGATTGTGTCCACTTCTGAGCCTCTTGTTGATTTGCCTATGGGCGACTCGAA
AGCAAACGAGACTGATGTTGCCACCGGTGTCTTGTGCAATGACAAGGCTCTCCCAACCATGGAGGACGTCTCGCGCCTCT
TCGACGACCAGACAGAGCAACAGGGGAATTTCAGTATGGGTCCATTGACAACCCCACGCATTGGTAGCTCTGACATGCCA
TCGCTGGCGGGCCTCACACCTGTTCAGAGCATCAAAAACGTTTTCAAGGATGTTCCCGTGGGTGGAGATATCAGCAAGGC
CCTTAATTTGACAGCCGCTTGGCGATCCGGCCTGCCGACTCTTGAAGACGTCGAAGAAATGAAGATTGCTGTGGTGCTTA
ATTTCCGTCTAAACTCCAGCAACTACGCCACTATCTGCATGCGTGAGATGATGAGCACTGCTTTCAATGTTGCCCCAGAG
ACGAACAGCAGCGGATCTGGATTTGGCCAGCTTCTTGGCCATGGTGGACATATCCATCATGAATCTGTGGGCCACACGAC
GAGTGTCAGTCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62