GenePrediction:GLEAN_5218 Details

Name: GLEAN_5218
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1128807..1127954 (- strand)
Length: 854
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1128807..1128766 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:1128697..1128681 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_97:1128359..1127954 (- strand)
Length: 406
>GLEAN_5218 class=GenePrediction position=GCSC_97:1128807..1127954 (- strand)
ATGTACAACTCGATCCAGGTCGGCACCGTCATCGCCTTTGTCGTCACCTACTTCTTTGCCTTTGTTTCCTTGCTCTTGCG
CTATTTTTAGGCTTTCCGCATTGTGCACAGGATCGAACCGGATCTGGGTATGTTGCCATACGATGTACAGAAACTGACAC
GCACCCAAGACGACATCCGTTAATTGCTTCCAGTCATCCTCACCGTATCTGCCGGCACGAGTTTGTACTACTTCATCACC
CTCACCAAACGTCCGTGTTCTCGTCGTAACCTCCTGCTCGTGTCCGCCTGCTGATGAGCCACCTGTAGTGATGAGCCATG
GCTGGGGCAGGCACCTTGGCACCTTGACGACGAGCGATCTGATTGCCTTCAATAATGTAAAAAAGTAGTGCCTCTGTTGC
ATGCGTTTGCCACACTCTAGCGCCAGTCCAAGCTCGCTCACATCCTAGGTTATCCTGCCAAATACCATCCGAGGCCATTC
TGGGCATCTGGTCCGTTGTCGAAATCAACCTCGGCATCGTCTGTGGCACGGCTATGCGTCTAAAGCCCTTCATCGTCACC
TACCTGCCCAAGCTGAATCTCCTTAGCAAGCGCTCGACCGGCCGCTCCTACGTGCCCTGGAAAGACACACTCACAAAAGC
CGACAAGGGCCAACACTCGTACCAGCTGCACAGCATCCAGCAGGGCAGCCGAGAGCCGGTCTCAAAATCGCCCCAGGGCC
ACAACATTCACGTCCACGAAGAGACCAACGTGCAAGTGGAAAACATGGGTCAGAGCCAAAGCCAGAGCCAGAACCGGAGC
CGGAGTCTGAGTCGGAGCCAAAGTGTTGATGACAGTAGCGTCGAGCTGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62