GenePrediction:GLEAN_521 Details

Name: GLEAN_521
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:330759..333553 (+ strand)
Length: 2795
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:330759..330845 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:330931..332466 (+ strand)
Length: 1536
Type: CDS
Source: GLEAN
Position: GCSC_97:332520..333415 (+ strand)
Length: 896
Type: CDS
Source: GLEAN
Position: GCSC_97:333487..333553 (+ strand)
Length: 67
>GLEAN_521 class=GenePrediction position=GCSC_97:330759..333553 (+ strand)
ATGAGCACCGACGAGATTCACCCAAGCAAGCGACGGTTCTGGAGCGGAATCTTACGCTCCCTCAGCACAAAAAAGACAGC
CAAACTTGTAAGTCTGCAGTGGGCCCCCGATCTTTTCCTCTCCCCATTTATACGTCTGTCTAGCGGTCTGACCGGGCGGG
CTCTGGATCCAGGAAAAGGAACGGCCCTGGAAAGAAGAAGATGACGAACCCACGGTCGAGACACCCCCAGTCCAACCGTC
GCAGCCAGTCCGGCCTCAAGGGGGCCTGGTCCGCGCGCAGACCCAGGTCCGGAAGCAGAACACGATCCCAGAGCAGCAGC
CACTCCCCCGCCAACGCGTGAGGAGAGAGTCGAAAGAGAGGGTTCCCAGCAGACGGACCACCCCACCGACAGCTGCTGCC
AGTGTGCCTGCGACGCCCGCGCCTCCCGGGCCCCTGGCCCCCCCTGGTGCCACGGCTGCGTGGAGAAAGCATAGGGAGAG
CGTTATCCCGGACGGCCGGTCGCAGGTGGTCCTGCAGCCCGGCCCGCTGACCGAATGGCCTCCATGGGGCGTGCCGGTAA
AGGCCGAGCTGCCATTGAGCAGCGCGATGGAGCTCATCGCACGTGGCGCCCCCATCCACAACGGCCATAAGCGGGACGTG
CCGCATGCCCCAGACGACTACTACACGCTCTACACGACCTCGTCAGGCAACCAGCCGGATGCGATGGCCAGCAGCAGAAG
CGGGAGGCGAAGCCGCGTTCAGTTGGGCCGGGACCGCAGCCTGAGCAGCCGCCGAGGCGACCGAGTGCCGAGGCGAGAAG
AGGCCGCCGGAAGCCCGGCCGACGGCACCGACGGTGCCGATCTGTACGATTCGATGATGGAGCTTATGACGATGCGCACG
GCTCAAACCCCCCGAAGCGCGCACCTGCCGGTGCTTTACCCGTGGGAGACGCTCGAGCAGCCGAGCTTCGCCTTCTGCTT
TGGTCGCCGGCCAGGCACCGTCACGCTCAACCACTGGGCCGGCCAGTCGGGCGTGCAGCCGCCTTCGATCGCCCTGCGGG
ATTCGGGCGTGCGGCCGCGTGACGTCAGCCTTATCGAGATCTGCCAGCGGCTGCGTGAGCTGCAGCGTGACGGCCTCGAG
GACGACGACCAAGAGCGGCTGTACCGGAACCTGTACCGGCGGCTGCTGCGGGACCCCGACCGCGGTTCCAGTCCGCGGCG
CACGTTGGACAAACAGATCACGGACCTGATCATGGCCCTCTCGCGTCCGGACTACTGGATCGACTTTACGGCGGCGCGCA
ACCAGATCGTCACGCGCTTCATCTTCGACACCGGCCTGGCCAGCCACCAGCAGTACGGACGCTTCTTCCACCAGCTGCTG
CTCAGCATCGAGCTCGACCTGCGCATCTCGTCGCGGCTGCACGACGAATGGGCCAAGGAGAAGCTGATGCAGCAGCTGCC
GCCGACGCTGCAGTACGACCTCGCTCTAGCCCGCCGCTGGCGTGAGCACGTGCGTATCGAGAGCTACGGCAAGACGGCCG
ACCAGGTGCAGCTGCGGTTGAAGCTCAAGAGCCGCCAGATCCGCCTGCTGCGCCGCTTTGCCCGGGCGATGAAGTGGCCC
AACCAGGCGGCCATGGTGGCCAATCTCAAGCAGCGCGATGCCGACGGCAGCCTTGAGTCGATCAGCTCCCATGTTATGGC
ATTCTTCAGCGGGCTTGTCCTGCCGGGAGTAAGCACTTTGACTGAATAAGCCCCTTTCAGGACCTGACTAACCTCTATCA
GCCTACATATCCGTTTGTCCTGATGAACGCACTCATCGACATCGACCCGGACCGCGCCACCGACGACCTGTCGATGCTGA
CACACATACACCCGCACTGCGGCTTCCAGTACCGCAACAGCTACACGTACTGGACGTCCACGTCGATTGTGGGCAAGGTG
CTTGCTCCGACCTGTCGCGAGCTGGCCGGCTGGGTGGGCCCTGCTCGGCCATCTGTCGATCTGGGCCGGTCACAGATTGC
CCGTATCCGGTCTCGCCGGCCGCGGCAGCGCCTGACCGTTGACGATGTCGTGTCGATGAACGACCGGTCCGACCCTCTCG
GGCCAACGTCGGAGCTGTTTCCCATTGCCGACTACAAGCTCGTAGCGACGGATCCGACCAACATCATCGACACTGTGCGG
ATCGAGCTGCTGAGCTTGCGGCCAGCACCCAAGCCAGACGGCCCAGGTGGCAACGTCGGCGGGACGTCGAAAAGCCCGGG
CTGGTTCGACGCCTCGGTGCAATTTGCCATAGACGGGGTGTCCTGGCCGCTGCGTCTCAACTTTGACGTGTCCTTTATCA
GCGCGTGGCCCTGCTCCAACGGGCCGCATCCCCTCTTTTTCGACTACGCCTTTGCCGTCATCAAGGCCGACACGGTCGTC
GACGTGCATGACTGGGCCAACTCGGCTTCTTCCTACGGAAAGGGCCACGGCCATAGCCGGACCTCGTCGCCGACTGTGCA
CTTTGGAAGCACGCGGATTCTGGGCCAGCAGCAGAATCCGCCCGTGTCCAAGGACGGCGACGAAGACAAGGTGCTTGTGA
TTGAGGCGTTTGGCGTGCCGGACAATGAGGTGCTCGCCCGTGCATGGTGTGCCCATTGGGGCCTGGGTGCCATTGTGGCG
GATGTGAAGACGACCTGGTAAGATTCGCGCGTCTTTGTTCTATTTCAAGACTGACCGATCGACAGCATGGCCTGTGCCGT
TCGCGAAGGGCTTATGCAGCCACCATCACGGTGGTGATCCTGGTGGATGGCCAGGTGATCAACAGCGACGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62