GenePrediction:GLEAN_5220 Details

Name: GLEAN_5220
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1124428..1123169 (- strand)
Length: 1260
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1124428..1124350 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_97:1124288..1123831 (- strand)
Length: 458
Type: CDS
Source: GLEAN
Position: GCSC_97:1123750..1123627 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_97:1123555..1123472 (- strand)
Length: 84
Type: CDS
Source: GLEAN
Position: GCSC_97:1123299..1123169 (- strand)
Length: 131
>GLEAN_5220 class=GenePrediction position=GCSC_97:1124428..1123169 (- strand)
ATGACGACAGCCTTTGGTTTCGACACAAAGGTGGACGAGGTTGCCAGCGCATTCAAAGATGCCATCCGCGGGAAGACAGG
TCGGTTCCCTGGCCACGCAACTTCGCTCTTCGAAGCACCTTGAGGCTGACCTGCCCGTAGTCTTGATCACAGGATGCAGC
CCCAATGGGCTCGGCTCAGAATCGGCTCGTGCCATTGCTGCCCACGACCCGCAGCTGCTCATCCTCGCAGGCCGTTCCAG
AGCGAAGCTTGAGCAGACAGAGGCGGCCTTGAAGCAGCAGTCGCCGCGGGCCAGCGTGCGCCTCCTCGAGCTGGACCTTG
CCAGCCTGGCATCGGTGCGGCAGGCGGCCGACGTAGTGAACCAGTACAGCGAGCACATTGATGTGCTGATCAACAATGCC
GGCATCATGGCGACGCCCTTTTCCAAGACCGTCGACGGCCTCGAGTCGCAGTTCGGCACCAACCATATCGGCCACTTCTT
GTTCACGAACCTGATCTTACCGAAAATCCTAGCTGCCGGAGAAGGCGCCCGGATTGTCAATGTCAGCAGCCTGGGTCACC
TGCTAGGGCCGGTCCGCTATGATGATTCCAACTTCGAGGTCGGTTACTTGGAAAGCCCAGATGACTTTTACCTGCAATAG
GTGTCCACATGACTGACGCCTACCTTTGTGCCATATAGAAGGGAGACTACAACAGGTGGGCAGCATATGGACAGAGCAAG
ACGGCCAACATACTGTTCTCGGTGGCCCTTGCCGACAGGCTCAAGGCCAGAGGGCTGCTTTCGTTCAGCCTCGATCCCGG
AGGTGGGTAGTTACCTGCGACGTAGAGATCAGCGTGGATAGTAACTTGTCGGGAGCTGACCGATACGTTTTAGCATCTGC
TGAAACAGGAATTTCACGTGAGATAGAGCTGGATGAGCTCAAGGAACTGGGTGAGCAAAACCTGATCGATCCCCCCCGTA
CGACATCATGCTGACTACGAATGCAGACGGAATACTACCCATGAAAAGTTTCAAGACGTTAGCTCAATGTGCATCAACAC
ACTTGGTGGCCGCATTCGACCCTTCAATTAAAGGTAATTTTTCCTTCTGTCTTCACAGCAGGCTTGGAAATGAGTGGCTA
ACAGAACAGACAACAACGGGGACTACTTGTGTGATTGCCAGATCACCAAGGTGACGGCTCCTTGGGCTATTGGACGAGAC
AATGCTGATAAGCTGTGGGCATTGAGCGAGTCCATTGTCAGGGAGCAGTTTCGCTATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62