GenePrediction:GLEAN_5223 Details

Name: GLEAN_5223
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1108628..1106346 (- strand)
Length: 2283
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1108628..1107398 (- strand)
Length: 1231
Type: CDS
Source: GLEAN
Position: GCSC_97:1107350..1107260 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_97:1107007..1106728 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_97:1106672..1106346 (- strand)
Length: 327
>GLEAN_5223 class=GenePrediction position=GCSC_97:1108628..1106346 (- strand)
ATGACGACACCGACAGCGGGAGCGTACGGGCGGCAGGGTCATCAGCCCCGCCACTCCGGGTCATACGGGACGTCAGAAGG
AGCAGCTGCGAGCCGCGGCCGCACACGGCACACGCTCCTCCTCTGTTTTGTGCACGGCTTCAAGGGCGACGCGGACACGT
TTGGGCCGCGGTCGCGGTTTGCGCACGAGCTGGGGCGACGGGTGGCAGTATCGCTGCCGCGCGTGGACGTGCGGGTGGCC
GTCTACCCGCCGTACCAGACGCGGGGCGACCTGGCGGCGACGGTGGTTCGCCTGCGCGACTGGCTGACCGAGACGGTCGT
CGACCTCGAGGTGGCGGCCGGCACGCCCAGCCCGACGGTCGAGCCGTCGGTCCGGTGCGTGTTGATGGGCCACTCCATGG
GTGGCATCGTGTCGGCCGACGTGTTGCTGTCGCTGGTGGGCGACCGGCGGGTGGGCGACAGCGACACGGATAACACAGAC
AAGGAGCTCAACGGGCTCATGTTTCCGTACGTACAGGCCGTGCTCGGCTTCGACACGCCGTACCTGGGCATCGCGCCCGG
CGTTGTGGCCCATGGCGCACAGGACCGCTACGCGGCCACGACGGCGGCCTTTTCGCAGATCAGCAGCCTGGCCGAGGCAC
TGCTGGGCAAAGCTGGCGGAGCCGGAGGGGGCGAGCAACAGGGAGGAGAGCAGGCCAGAGCGGGGATCACCAGGACCGAA
AGTGGAACGGGAACGGGAACGGGAACCGAATCCGGTCCCAGAACGGCGAGAATGGCAAGAAGTGCAACGGCCCCCTCCAC
CTCCACCACATCCACGCCCTCTTCCGCCTGGGGCTGGGGCAGGATTGCGCTGGTGGCCGGGGCCAGCGCTCTGGCCAGCG
GAGCTGCTGCCGCCGTGGCCTATCGCAACCGCGACCACCTGACCGAGGGCTGGTCCTGGGTCTCGTCGCACCTCGAGTTC
GTCGGCTGTCTCGCCCGCGGTGAAGACCTGCGGCGTCGCATCGCCCGCATTCAACAGGCCCATCGCCAGCTCGGCGTCGG
CTTCGGCAACCTCTACACCCGCCTCGGCCGTGCTGCCCCGTCCAAGCAGACCCAGACGGCCACCGGCGCCAACGACCTGC
TCCTGCTGCCGTCTGAGCGCACCTTTTGCGTCCTGCCCAGCCGCGAACCCGCCGGCGACTGGCGCGAGGCCGTCAACGAT
GATGCCACCGACGAGACTCGCGCCCACATGAGTACGTGTTTTTACTGTTTTCCCTCCCCAACACCAGCTGACAACCAGGC
ATGTTCACCCCCGCCGGTAACCCAAACTACGACCGCCTGCTCGCCGACGCCTGCGACATGGTCTCCCTCTGGACCCGCGG
CTCCCAGTGGTACGAGACCAGCAGCATCAGAAAGACGCAGGCGCTATGAGTCCCTGCGTTGTGTTTGGCGGCCATGATAC
ACCCCTGAATCGTCTTTTTCGTCTATCTATTCTTTTCTTGCCAGTTCACAATATCAATACAGTCTCGTGTGGCTTCAGTA
TACCTGCTTCCGCCCGCTTGCCCGTGCTATAGCGTCATATCCCCCCAGCTCGCCCCTGTTCTCCCGCAACCTCTCCTACT
GAACCTTCTTGCCCACAGCAGCCTCTGCCTTGAGCCGACGCAGAACCTTGCGCCGCTGGGCCAGCATGTGCGTGTACAGG
ATGTAGGACCCAGGCACATACACGGCCAGCACGGCGTAGAGCGCGGCCGGGTACAGCGGGTGCAGAGTGGCGGCCGCGCT
GGGCGTGGTGGCAGCCAGGTAGACGAGCCGCACCTCGGAGCTGATGCCGACCGGATACAGCACCAGGAACGTGCTGTAGC
GCAGGGCCGTGAACCAGGACGGCGGCGGCCGTTCGGGCCCGCGCGCGAGACTGAGGGCAAAGTACGAGTAGCGGATCACC
TCTGTCAGGCTCCAGGCCAGCACCATGGACGTATAGAACGGACTCGACGTCGTCTCGGCCGGAAACGGGTACACAATGGC
CCACACGAGCAGCAGCCGGCTGGCCACCTGCATGGCCGTCGTAAACAGGGGCGCGCGAACTATGCCTGCGAGGCTGTCAG
CGATTGTCATTGAGATCGGCATCATCGTTGCAGGAGCGCCCATACCCAGCACCGAGTGCACCACCTCCAGCAGAGCAATG
GTCTGCGTGCAGCGCAGAAAGTCGTCCACCACAATCGGCACAAAGGCCGGCCCGCGGAGACCCGCCACAATGGCCGTGCG
GCCCAGCACTGTCGTCCACAGGATGGCCGAGATGAAGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62