GenePrediction:GLEAN_5224 Details

Name: GLEAN_5224
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1102992..1102667 (- strand)
Length: 326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1102992..1102915 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_97:1102789..1102667 (- strand)
Length: 123
>GLEAN_5224 class=GenePrediction position=GCSC_97:1102992..1102667 (- strand)
ATGGATGCCCCTACTAAGACCGTCACTATGGAGCCCACGGCTGCCAAGAACGCCGAGATGCGTCCCGTGGAGCAGCCGGT
ACGTTCTATTGTCCCTTCTCCTGGATTGAGCGGCATTGGCACACGTCATTCTGCTTGGCAGTATTGCGAAATTTTGAGCC
GCACTCGCGCAACGTCACGGTCTTCTAACCCGTTTTCCATCAGGCACGCGTCGAACCCATGTCTATTGACAACGTCAACA
TGCGTGGTGGTGACGAGGGCGAGGAGGTCTGCTGCGGTCTCTGCGCCGCCTTTGCCTGCTTCGAGTGCTGCAAGTGCTGC
TGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62