GenePrediction:GLEAN_5225 Details

Name: GLEAN_5225
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1094171..1091761 (- strand)
Length: 2411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1094171..1094063 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_97:1093985..1093615 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_97:1093558..1093548 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_97:1093368..1092471 (- strand)
Length: 898
Type: CDS
Source: GLEAN
Position: GCSC_97:1092018..1091761 (- strand)
Length: 258
>GLEAN_5225 class=GenePrediction position=GCSC_97:1094171..1091761 (- strand)
ATGTGGCGCCGCATCTACTTCCTCCTGTTCTTCGTCCGGCTATGGTTTGCCATGTCTCCGAGCTACCTGCATCCGGACGA
GAACTTTCAAGGACCGGAAGTCATTGCTGGTGAGTGTGGGCAGATGCGACAGAGATCGTCTGTGGCGCAGCCGGCGCACA
CATGCTGACTCTTCTCTCCACTGCAGGCGAAGTCTTTAGCTACCCGGTTCATCGTACCTGGGAGTTTACGAGCGAACACC
CAATCAGGAGCGTGTATCCGCTATGGACGGTCTATGGAATGCCCATGATTCTTCTCCGCTGGCTATTGGGTAACGAAATC
CCACCTTCGACTGTCTTTTGGGTGCTGCGCGGCCTCATGTTTATCATGAACTTTGTCCTGGAGGACTGGGTCATCTATGA
GCTGGTACCATCCAAGCGCCACCGCGAGACGGCTGTCGTGCTGCTGGCATCTTCCTACGTCACCTGGACCTACCAGGCAC
ACACCTTTTCGAACTCGGTCGAGACGCTTGTCGTGGCCTGGAGTCTGGTTTTAATTAAGCGCATTGTTGCACGACCGGTA
AGGCTATCTTCTTGCCCATTTGGACACAGGTACTCTGTGGCTAACTTTCAAAGAACCGCGATTCGTCCGTGTCCTTGATT
ACACTCGGAGTCGTCGTTGTGTTTGGCGTCTTTAATAGAATTACATTTCCCGCCTTTTTGCTCATTCCTGGTTTTTATTT
GATACCCTATTTTTTCCATAAGTAAGTCACCTCGATTCCAGCCCCCGGCTTGCCGACAGGGCACGCTCGCTGACTTGAAT
CAGTCCTTTGTCTGTCATTCCTCTGGCTTTGTCGGGCCTTCTCACGACGATTATTGCCGTCGCTTTCGACACAGCCTTCT
ACACCCCTCACCAGATCACCTGGCTTGACCTGATCCTCTACCCAGTCATCACCCCCCTAAACAATCTCATGTACAACATA
TCTCCCGAGAACCTTGCTCAACATGGCCTGCATCCGTGGTACCAACATCTTTTGGCGAACCTACCTATGCTCGTCGGCCC
CGCAGTTTTGCTCCGGCCCGAACCATCTTTTCGTCTTTTCTCGGCTGTTTCGGGCATCATCGTGCTCTCCTGCTTTCCGC
ATCAAGAGGCACGGTTTCTTTTGCCCACCATCCCGCTTTTTCTCTCGTCAGTACGGCTTCCGAGCAAGCCGCGCCTTTTC
TATTCCTGGGTAGCCGCGTGGACTGCGTTCAATGTAGTCTTTGGCATCCTGATGGGTGTCTATCACCAAGGGGGTGTCAT
TCCTACTCAGATTTTCATGAGCCAGCAGCCAGATGCGACGCAGGCTATATGGTGGAAGACGTACAGCCCGCCTATATGGC
TGCTGAACGGCAAGAATGCAGTGCTGACCACGCACGATGTCATGGGAATGCCTGGCGAAGACTTGATGGAGCAGCTGGCA
GAGCTAGCCACGTGTGACAGGCCGGCCGATCGACGGAACAAAGAGTACCTGAAGGAGAAAAATGGCACTTATCTGATCGC
GCCGGTATCAGCAACTTGGCTCGATCCGTATCTACGCAACAAGGGCCTGGAGGGTCTGCGTTTCCGACAGGTTTGGAGCT
ACCGCCAACACCTCAACCTTGATGACCTAGATTGGGGGGAGGATGGTGTGTGGAACACGCTGAAACGAGTAATAGGGCGG
CGAGGGCTGGCGGCATGGCGTGTAACAAAGAGCTGCCTGGAGGGGGTGCAGCAATAAAATTTGTATATAATATTGTATAG
GTGATCGAAAGTAGATGACTAATCTTTATCTGTGTTCTTCAAGTGACTTCATGCGCAACCAATGACGAAGCGGTAAAAAA
AGAACAGAGCATTTTAGCGCTCCCAAAGAAGCCTAGTGACTGGAGGCTCAACTGACGAGTTTGGCCAACCTCATCCGACA
ATTTGCCTTCTCCACGCCTCCATTGCGCAGAGAGTTGAGTACCTTCTTCCCCGATCCGATCAAAGAAGCGAAGTCCGGCG
CCTTATACAATTCCGTTACCCTTCGCAATCATCTCGAAACTGCAGAACTGTCTCGAAGATGGGCGGCTTAAATTTGGAAG
TTTTCAAGGTACTTTACAACCCTTCTGTGTCCGCTCTTATTGCTCTTCCGTCGGTGCTTAACAGACTTCTCAGTTTGGCA
TGTATGTCCTCTTCCCGATTGGCATCATGTACTACTTCGGCACCAACCTGGATGAGCGTTTTGCGGTGCCGGACTTCTGG
CCCAAGGCCGAGAACGCCAACAGCGTGCCGACTGAGCGAGACGAGATCCACGCCGAGCTGCAGCGACTCCGTGCGCGGAG
ACTGTATCTGCGTGACCGCCGGCTGGCATCTGAGACCCAAGGTCAGCCGACAGGGGTGCAGGACCAGACTGTCGGAGAGG
TGCGCCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62