GenePrediction:GLEAN_5226 Details

Name: GLEAN_5226
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1090099..1083407 (- strand)
Length: 6693
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1090099..1084088 (- strand)
Length: 6012
Type: CDS
Source: GLEAN
Position: GCSC_97:1083976..1083407 (- strand)
Length: 570
>GLEAN_5226 class=GenePrediction position=GCSC_97:1090099..1083407 (- strand)
ATGTCATCGGCAGCGTCAGCGGGTGGCGACAACTCTCGCGAGAGCACGGTCAATGGCGAAGCAGACGATGCTGGCGAAGT
GGTAGCGGTGGCAGCGGTGGCAGCGTCGGCAGAAGCGGCAGGGGCTCATGCAACGGCAGCAGCTGACAGCGCGAACCCGG
AACTAGACACGACGCATCTGGCGAGCCTGCCGACAGAACAGCAAGAGCTTGCGCTGCTGCAGTTTGCGGCGCGGCTGGAC
AAGCACGTGAGCGGATTGATAGCGGACGACTGCACGGCGCAGCAGTTCTATCTGAAGAAGGAGGTGTTTAAGATTCTGAA
CCTGACGACGCCGTATCCGTCGCGCGTGGTACGCAACACGCTGGGGCGCTGCCTGGCGCAGGTGCTCAGCCGGGGCGACC
GCAAGCTGCTGTTTGAGACGATCAACGACCTGAACGGAGTGGTGGCGAACAGCGGCAAGATCCGGCTGGACGGTGGGGGC
GAGGGCCGGACGAAGCATGCGGCGGTAGTCTGCCTGGGCGAGGTGTTTGGGGCGGCAGGCGACAGTGCGATCAGCCTACA
CCACGTGACGTGCAGTACGCTGCTAAAGGTGTTGAAAGCAGCACAGGGGCACGCAGGGATGCGGGCGGCGGTGTTCAGCG
CGCTGGGCAAGCTGGTGCGGTGCATCGGGACGAGCTGCGACGAGGGGATCGCGCGGGACATCTGGAAGCAGGCGCGGAGC
CACGCGTCAGGCGACAAGGGGACGCTGGTGTCGGTAGCAGCGTGCCGGTGCGTGACAGTGCTGGTGCGGCACACGACGTA
TTTTGAGACGACAAGCGATTTTGAGAGCATCAGCAAGACGATCTTCAAGACGATCGACACGGCCTCGAGCCAGGTGCGGC
GGGCGGCAGCAGACTGTTTCGTGGAGGTGATGGTGAAGGGATACGCAGAATCGGTGTCGGGCAGCGGAGACGGCGGGGTG
GTCAAGACGGCGCCGCGCAAGCTGCTGCGGTCGAAGAGCGTGAAGCGGCAGTCGACGCTGCCAGCGGGCCTACAGGACGA
CGACGACCTGCCAGGATCGCGGGCGAGCAGCCCGGGGCCATCGGGGGGGCGAGGCCACAACGTGCTGTCGCTATCACTAA
ACGAGATGCTGAAGACGCTGTCGACACACTACGTGCGGCTGTCGACGACGAACCGAGCGCGAGCAGCGATCGGAGTGTGC
TACGGGCGGGTGCTGCAGCGGCTGGGCGAAAAAGCAGTGGAGCAGAGCTACCTGCAGATCATGGACAGCCTGACGGTGGA
GGTGCTGGGCCACGGCAACATTGCGAACAACCGGTACCGGCTGCTGACGGCGCGACGGATGGTGGACACGATCGTGCAGG
AGGTGGTGGGCCGACGGATCTTGAGCGAGGCCGGACAGATGGCGGCAGCGAAGGCGCTGGTGGACGAGATCCTGCGACAC
TACCCGGCGGTGACGCGGGAGCGGACAGAGCCGAGCAAGCAGACGCTGGTGGCATCGCTGGGGGCTCTGTCAGCGCTGAT
CGAGGCGTTGGGGTCGGCGGCGAACGGGGTCGCGGAGGGATGCCGGGACAGCGTGCTGCAGATGCTGCCACACCCGACAT
ACAGCGTGCAAGTGGCAGCGGCGGGATGCCTCCAGGCGTTTGTGCTGGCGTGTCCACAGCAGCTGCTGCCGTGCCTGTCG
GTGTGCATGAACAGCCTGACGCGGGAGCTGGGACAGCTGAGCGGCAGCGGAACGCAGCAGCAGCGACGGTGTCTGGGGTT
TGCGCACGGGCTGGCAGCAGCGCTGAGCGTGAGCCCTCTACGGGCACTATACGGATCGGTGGAGATCAACAGCCGGGTGC
TGACGATGGCGACGGACCTGCTGAAGACGAGCGGCAAGTCGGAGCTGCGGGTGGCGAGCGTGCAGATCCAGGTGGCCTAC
GTGCTGCTGGGAGGACTGATGGCGCTGGGGCCGAACTTTGTCAAGATCCACCTGTCACAGATGCTGCTGCTGTGGAAGAA
CGCGCTGCCACGGCCGCTGTCACGGGACAATGTGGCATCACGGACGTACCTGGAGACGTCGTTCCTGACGCAGATCCGGG
AATGCGCGCTGGGGTCGATCCTGGCGTTCCTGCAGGCCAACGGGCGGCTGCTGACGGTGGACGTGTCGAAGCGAATTGCG
GCGATGCTGCAACACACAGCAGCCTTTCTGAAGACGCTGCCGGGACGGAAGACGACGGAGGACATGAGCCAGCGGCTGAC
GCCGGCACTGCAGCTGTCGGACCTGGACGTGATGGTGCAGCGACGACTGCTGCAGTGCTACCTGCAGCTGATACGGCTGG
CACCGGGTGGCAGTGCCGAGACGCTGCTGCAGTCGAACCTGCTGACGCTGGTGGTGTCGCAGTTTGCAGACCCGGAACCC
AGCAGCACAAGCGGAGGACTGAGCGCGTCGATCGCGACGGCAGCCGGGGCCTTTGAGACGATCTGGGACGTGGCCGACAA
CGTGGGCTTTGGCGTGACAGGACTGGTGTCGGGATTCCGGGTGCGACGACTGGCAGGCCAGCACGAGAAGAGCGCGGCCG
AGGAGGAGCAGCAGCAGCAAGAGCTGCTGGCATCACTAGACGAGACAGCGGGGCCAGAGGGCGTGATAGAGAGCCTGCTG
CTGTCGCCCGTGTGCGGTGCGGCCGAACACGACGCATCGCTGCTGTATATCGGGGGAAGTGGAGGAAATGGAGGGGATGT
ACAGCTTCCCGATCCACCGGCAACCGAAGTGGTCAATCTGGCGATCCAGCTGTTCGCACACGTCTTCCCGCTGACGGTGG
CCAAGGTGCAGGAGAGCATCCTGGAGCAGCTGGCGACGTTCATGTCGGCCGGACAGCTGCAGCGCGACCCGGGACGCAAA
GCGGCGATCAAGGTGAACGTGGCGGTGGCGGTGCTGCTGACGCTCAAGGTAGCAGTGCGGGAGACGCCAGCAGCAGCGGG
CACGGTGACGAGCGCGGCCGTGGAGAAGCTGCTGCAGGATCTGGTGCGTGGATTTGTCCTGGACGCGGACCAGTACGTGC
GCAGCCTCGGATACGCAGCGATGGGACGGCTGTGCAGCGCGAGCGGCAACGCGTTTACGAACCAGGAGATCCGGTATCTG
GTGGACACGATCGTGGTGAACCGGGAGCCGGCTGTGCGCGCAGGCTGTGCGATGGCGCTGGGCTGCATCCAGACGCGGGT
CGGCGGGATGGCGGCGGGCTACCACCTGAAGACGATCCTGGGGATCCTGATGTCACTCTGTAACGATCCGCACCCAACAG
TGCACTTCTGGGCGCTGGAGGCCTTTGGCCGAGCATCGGACGCGGCCGGGCTAAACTTTGCGAGCTACGTGGCGAGCACG
CTGGGCATGCTGGCACAGCTGTACGGATCGGAGCAGCACCACGGCGAGGTGGCTTCGGCCGTGTCGATGAACCTGGAGGC
GGAGCGGTCGACGACAGCGGCGATTGCACGCTGTGTGGACGCACTGATCAACGTGTTGGGTCCAGACCTGCAGGAGACGA
CGCGACCGCGCGAGCTGATTCTGCAGCTGGTGCGCCAGTTTGGCGACGAGGCCGACGTCCAGGTGCGACGGGCGAGTCTG
GGCTGTCTCGAGCATCTGTCGCTGTATGCGCCTGGATTCGTCGACTTTGGCGACTATGTGCGCCGGCTGCAGGGCTATGC
CGTGTCGGATGACCAGGCACTGCGTGATGCGGCCATCGACGGGCTATACAACCTGATGAAGCGAGGAGCCGACGAGGTGG
TGGCAGCAGCCGAGCCCGGACTCGAAGACCAGCTCTGGCTGGTGCTGGACCGGCAGCCGAGCCACGAGGGGGTTCGAAAC
CTGCTGCGCAGCTGGCTACGACAAACGTGTCTGCAGGACACGGCAGCCTGGCTGCAGCGATTCCAGCGGGTGCTCAAGAT
GACGCGGCCGAAAGTGCCGGAGACGACGCGAATGGCAGCAGCATTTCAGGCGGCAGCAGCGGCACGAGTGGTCGACCTGC
AGGACGAGGAAGTGGCCGGGCTAGGAAACGCAGTAGGAGGAGGGGAAGAGGGAGGTCCGACCGAGAGCGGTCCAGGAGAT
GGTCCTGTCTCGGCTGGAGGCGGTGCAGGAACTGCTCCAGGTTTGGGTCCTTCTGTGGCCGATCCGGACGTGGAGCCGCT
GCGATGGCAGGTGGCGACGTTTGTGCTCAGCCTGCTGGCCGAGGTGTTTGAGCTGGTCGGCAAGGACGCGGCAGCGACAA
CCAACATCAGCGGCGAGATGTCCACGGCGACAGCAGCGCTGCAGCGAGGGATCGCCGACGTGGTCCGCATGGCCTTTTCG
GCATCGACGTCGGGCGTGCTGGAGCAGCGGCTCCGGGGACTGCAGATCATCGGGGCCGTGCTGCGCATGTTTGGCCGGGC
AGCCGATCCGGACTTTGACGAGGCCATGCTGCTGGAGCAGTACCAGGCACAGATCAGTTCGGCCCTGACACCGGCCTTTG
CAGCGGACTCGTCGCCCGAGCTGGCCTCGGAAGCCGTGCACGTATGTGCTGCCTTTGTGGCGACGGGCATCGTGACCGAT
GTCGATCGGATGGGTCGGATCCTCAAAACGCTGGTCGGCGCGCTCGACGGGTTTCTGGAGGCAGGAAACGACGAGGAGCA
GACGCGCGAAGGCGGCGGGATCGGCGATCTGCGTGGACTCAGCGCCAACGCGACCGTCATGGTCCGGATGGCCGTGTTTG
CAGCCTGGGCCGAGCTGCAGGTGGCCAGCCTGGAGCAGCGGTATCTGGTCGACGTGCTGCGGCCACATATTGGACAGCTG
ACTAAGCTATGGCTCGAGTCGCTGCGCGAATTTGCCCGGCTGCGCTTCGAGCCGGACATCTCGATGACGCTGGGGCCACC
GTCGCTGTCGGGCAGCCTAGACACGATCTACGCGGCACTGAACCGCGAGACCCTGCTGGCCTTTTACCAGGACGCCTGGC
TGAAGCTGGTGGACGCGATCGCGAGCCTGATCGAGCAGGACAGCGCCTTTGTCTTTGACGCGCTGGACGGAGGACACGGA
CAGGACATGGGTGTGCCGAGCGCCGAGAAGACAGCCAAGACCGAGGAGACAGACATCAACTACCGGGACGAGCCGGTCGC
CTTCTTCTTCGTCCTCTTCGGCATCGCCTTTGAGGCCCTGGCAGCACGACAAGGCCAGGCCGACTCGCTCGCGGCACCCG
GCCAGACGCTCGAGATTCTGCGGGCCCTCAAGAAGATCTTGCACCCGAGCGTGTCGGGCCAGGCCATCTACCGCGACGCC
GTCTTTGGCGAGACCATGGACCTGCTGGACCGCCTCGCCCTGACCGAAGGCCTCGACGTCCAGGGCGTCATCGTCGACAT
TGCCCGCGCCCTCTGTCTGGCCCATCCGGCTGCCCGGACCCGTGACGAGGCCGAGACCGGCGAGCTGTCCGACGACATCG
AGCAGCTGTTTGAGCTGACCCGCATCATCGTGCTCGTCCTCTCCGGACTGCTGCCCGAGCTCACGGCCACGCCGGGCGTC
CAGATCGCCATCACCACCTCCGCCTCCACGCGCTACGCCATGACCGAGGAGGCCGTCCTGCTGCTCGTGCGCGCTGCCCT
CGACGCGCTCGTCGACGCCGCCGAGGTCTTCCCGGCCGTCATCCGCACCGATCTCCACGCCTGTCTGGTCCACATCTTTG
CCACCATCCTGGCCACGCCCGCCTGCCAGGACGTGGTCGTGCCCCAGGCCCTGCCGACGCTCAAGCGCTTCATCGCCACC
GCCGGCCAGGACGTCCAGAACGTCCAGGATGTCCAGACCCATGCCCAGCTGCGCAGCTGTCTGCGCCGCTTCCTGTCCAT
CTACCTGCACGCCCAGAAGCGCGAGCTGCCGACCGCCCTGGCCTGCGTCAAGAACTGCCTGCTGGCCATCACCATGCTCT
TCACGGCCGCGCCCAACGTGTACCTCGCGGCTGGCGATCCGCTCGTGGCCAAGTTCCTGGACGAGCTGCTAGACTGTCTC
ACCGATCGGATGGTGAGTGTATTCCTTTCTTCTTTTTTCCTTCTATTTTTCGTCTTTTCTTTTCTTCTTTTCTTCCTTTC
GTCTTTTCGTCTCTACTCTTCTCCTTCCCCCTAACACACACAGACTGCCAAGATCGCCGCCAACTGTTGTCGCTCCCTCC
TCCTCCACATGCGTCCCGCCGCCGCCGACCAGAGCGTGGGCCGCTACCTGCTGCCGCGCCTGCTCGGCTTCGTCGCCAAC
ACCAACCGCGACGACCCCGAACACGCCCGCACGATGGTGTCGCAGACCCTGACTGCCTTTGTCATCGCCAAGTCTGCCGC
TGCCGCGTCGGCGCCCGACCCGCCAGCCGCCCGCACCGCCGTCGCCGTGGCCATGGCCCTGGTCATCCCGGCGCTGCTGG
CCCGAGCAGCAGGCGAGCTGGGGACGATGGAGGCTGGTGGTCCGAGTACGAGTACGAGTTCGAATGCGAGCACGACAGCC
ATCTACCGCGAGACTTCGGGCCGGCTGCTCGAGCTCGCGTCGGCCGACCCGACCGCCTTCCGCAGCGTCGTCGGCGGCCT
CGCCGACAACCAGCGCGCCTTTATGGAAGACGTGATCAAGGCCGGCCGGCAGCCGGACTCGGCGCGGACGGCGACGACGA
CGACCGAACAGCCGACAATCGCACTGAAGATGAACTTTGGAGGGGGAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62