GenePrediction:GLEAN_5227 Details

Name: GLEAN_5227
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1082917..1081853 (- strand)
Length: 1065
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1082917..1082876 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:1082827..1081853 (- strand)
Length: 975
>GLEAN_5227 class=GenePrediction position=GCSC_97:1082917..1081853 (- strand)
ATGGAGAAGGCAGCCGTTTCCAACGATGGACTTGTGATCCCTGTACGTGCTTTTCACTCTCTCACACACGCACACATACT
AACCGAGCAGCTGATCGACCTGAGCAAGTTTCTGCACGGCACCGAGGCCGACCGCGTGGCCACGGCCAAGGCCATCCTGA
ACGGCTTCCAGTCAGCCGGCTTCATCTACCTGAAGAACACGCCGATCACGCCAGAGGCGCAAAAGGCTGCCTTTGCCGCC
TCGGCGCGCTTCTTTGCGCTGCCGACCGAGAAGAAGGACGCGCTCGGCTGGACGACGCCGGAGGCGAACCGCGGCTACAC
GGCGACGGGGCGCGAAAAGGTCAGCGACCTCCACGACCGCGCCGAGGTCGCCAAGCTCAAGGCGGCCGTGCCCGACCTCA
AGGAGAGCATCGAGATCGGCCGCGAGGACGAGGACGGCTGCCCGAACCGCTGGCCGGACGAGACCGATCCGGCCACGCGT
CCGCTCGTCGCCGGCTTCCGCCACACCATGAACGACTTCCACGCCCAGTGCAAGGCCGTGCACGAGGAGGTCATGCGCGC
CATCGCCGTCGGCATGGGCCTGCCGGCCACCTTTTTCGACGCCTTTGTCGACGTCGGCGACAACACCCTCCGCCTGCTGC
ACTACCCCGCCGTCAGCCACGAGGTCTTTGCTCGCAACCCCGGCCAGGTCCGCGCCGGCGAGCACTCCGACTACGGCTCC
ATCACCCTGCTCTTCCAGGACAGCCGCGGCGGCCTGCAGGTGCGCAGCCCCAACGGCAATTTTGTCGACGCCACCCCGAT
CGAGAACACGATCGTGGTCAACGCCGGCGACCTGCTCGCCCGCTGGAGCAACGACACCATCAAGAGCACCATCCACCGCG
TCGTCGAGCCGCCCACGAGCGACACCGTCCACCCCGCCCGCTATAGCATCGCCTACTTCTGCAACCCCAACTTCAAGAGC
TTCATCGAGGTCCTGCCCGGCACCTTTGGCACCGAGGCCGAGAAGAAGTACGAGCCCGTCACCACCGGCAACTACATCAT
CCAGCGACTCGCTGCCACGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62