GenePrediction:GLEAN_5228 Details

Name: GLEAN_5228
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1080689..1078097 (- strand)
Length: 2593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1080689..1080212 (- strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_97:1080136..1079818 (- strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_97:1079744..1078097 (- strand)
Length: 1648
>GLEAN_5228 class=GenePrediction position=GCSC_97:1080689..1078097 (- strand)
ATGGCTCAGCCCTCTACTCTGGGAACCTCCTCGATCAACCCCAGCGCGCCTGATGCCACAGCCCCATCGTCCATCTTTGG
AGGCGCAGTGTTGAATACAGCAGCAGCAGCATCACCGACAACAGCGCAGACAGCACCGACTGCACCGAGAGTGCCAGCAG
CGTCTGCGTTCCTTTCCGTCGGCGCCCTTTCCTCGACGTCCGTGGCCTCCAACAGCACATACATCATGCCCAACTCGCCG
TTACGCAATCGCCCCGGCGCTGATGGCTACCGCCCCAAGGTGACGCGCACGCTGGGCCAGCGACCGGCCTGTCTGGTAAA
TGCCTCGGTGACGTACTGCGGAAACAATCAGATCTACGCCTTTGGTGGCTTCGATCAGTATACCGATGAGGTCTACAACC
ACGTCCTCCGCCTCGATGTCGTCAGCCAGCAGTGGAGCCTCGTCGACAACTACGGTGACATCCCCGGCGTGCGCATGGGT
GAGCAAGCGTCCAGACAAGCCTCTCCTGCCATTCCGGCTGGCAGTCCTGCTCATACTAACTGATATTCGCCAGGCCATAC
CGCTACGCTGTACCAGGGCGATAAGCTGCTCGTCTTTGGCGGCGAGAACGAACACCGAACCTACCTCTCCGACCTCATCG
TCTTCGACCTCAAGACAGCTCATTGGACTCAGCCGCAAGTGTCTGGGCCTATCCCCAAGGACCGTGCCCGCCACGCGGCC
GTCCTGCACGACGACAAGCTTTTCATTTTAGGGGGAATCACGGGCCGCGATAACTATGTCCTCGACGACATCTGCTACCT
CGACCTCAAGACGTACACTTGGTCCCGTTCATGGCGCTTTGTCAGCCGGTTCGACCACTCAGCGTACATCTGGTAAGATA
CTATGGCGGACTTGGCGTCGGGCGTTTGCTGGTCGCTGCGAAAAGCTGACTAATCCAAACCACAGGGACGATCGGGTGTG
GGTGTTTGGCGGCTTGAGCAAGGACATGGACAAGGTCAGCGATCTGTGGTGGCTCGACCTGAAGGGCTCGCCGGCCTTCC
AGTCGGCACCACAGTTCGGGTCCATGTTCGACCAGCAGAGCATGGCCAGCCGTGGAGGCAGCATGTCGCGGCCCGGCTAC
TCAGCTCAGTCGTCGACTGTGGGCGCGTCCGGCTACGCGGCCAACTCGCGCACGGCCCAAGTAAACACGCCGTCGTTCCA
GCTCAAGTCGTACTCGCCCGTGGCCCCGGGGACGATCTCGGTGCTCAAGTTCTGCTCCGGGCTCAACATGCCGAATCAAG
GCTCCGGCATCCACTTCCACGTCTACTCGTCCGGCGTGCTGCTGGACTTTGTCACACCGGCGGCCACGATCACGTCACGC
GAATGCTCGATGAACACGCTGGACCTGGCCACCATGCGCTGGCAGCGGCTGGCCGAGGGCCGTGAGATCTTCAAGATGGG
CTACCGATGGCACTACTGCACCATTAACGAGGACGGCACCAAAGCCTGGCTGCTCGGCTGTCCCAACGACCCGGGGTCAG
TCGACCTGGGCACGAACGGGCTTGAAGAGTACCTGAGCGACATCATGGAGATCGACCTGCGCCGCTACGGCTTCCTGGGC
AATACCGTGCCCGACGCCCGCAGCGAGCTGGTGCGACCGACGTCTCGCGTCCGTCATATCGATACGCCGTCGCGCGGCCT
GGGCTCGGATCTGGCTAAGCTTTTTGATCAGCCGCCCGAGGCTGGGAGCGGTGCTGACTTTATTGTCACCGCCCACTCGG
GCAACTGCGACGACGACGACGATGACGTCATGGGCTCTGCGCTCATTCCGTCAGGCGAAGGCCCGGATGGCACTGGTGGT
GGCGGCTGCAGTGGTGGCAGCACCTGGCTGTCGCCCGACGCACCTACGTCGCCGCCGATCCACGTGCACCGTCTCATCTT
GCAGGCCCGGTGGCCGCATTTTGCCCGGCTCTGGTCCTCGCAAATGGCCGAGTTCCACACCAAGCGGATGCACATCCCGG
AGCCGTACAGCGTCGTGCGGGCATTTCTCTACTACCTCTACACGGACCGGATCGACCCCCCCGGCGCGACCGGAGACGGC
GCGGCGACGTCGTCCGCTGGAAGTGCTGGTGTGGGAACGACCTCCGGTGGCAGCAGCAACATGACGGCCGATCTCTCGGA
TGTGGCTGGGCTGCTGGTTATGTCCAACATCTACAACATCCCGCACCTGCGACTACTGTGCGTGAACCGGCTGTGGCGCG
AGCTGGACGTGGAGCACGCGTGCATCATCTGGCACTGCGCCAGCTTGGCGAATGAAGAGTGGCTGCGCAAGCGGGCAGCC
GGCTTCTGCCTGACGCACTGGGGCCGCATCGTGCGATCGTCTGGCTTTCTTCGGCTGCCGCGGGCGGCGCTAGTGGAGCT
CTCGCAAGAGATCGACACGGAGGGCCGTGTGATTGGTGGCGACGAGCTGGACATGTTTGGATCTGCCATGGACGGAAACC
GTTACTCGGATACCGGCAGTATGGCGTCGCAGCGGAAGGAGAGCGTCAGCAGCCACCCGTCGCAGATGGCCGAATCAGAA
GCTGAGGACGAGGACGGCATGGAGATGAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62