GenePrediction:GLEAN_5230 Details

Name: GLEAN_5230
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1066448..1065012 (- strand)
Length: 1437
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1066448..1066392 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_97:1066272..1066212 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_97:1066115..1065982 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_97:1065922..1065739 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_97:1065685..1065012 (- strand)
Length: 674
>GLEAN_5230 class=GenePrediction position=GCSC_97:1066448..1065012 (- strand)
ATGCATCGCACATACTCCATGCGCCAGTCGCGGGCGCCTACCGCTTCGCAGATTCAGGTACGCTTACTCACCTGACTACT
GAGTCGACTGTTCTCCCGGTTGGCAGGGCTGCCCATTCAATTACCGTCCCCTCCCAAGGTTGAGCTTTATTATGCTGACG
GTGCTAATTCTTTTAGAACCCTCCGCCACCGCCCTCCACCACCAAAAGCGGACGACTCTTCGGTCGCGGAGGCTTCGGTA
TGTTGCCTACTTGTTGCCAACTCGCAAATTTTCGTCAATGCATTTGCGACGTTTGAGAGAACTTTCGCTGACTGGTGTTG
GTACTTTTTGCAGGCCATGCGCTCAGAAGAAACGCTGCCGGCGCTTTCGGGCCCGACCTGTCCAAGAAGCTGTCCCAGCT
CGTGAAGATGGAGAAGAATGTCATGCGTAGCATGGAGACCGTCGCCAGAGAGCGCATGGAAGTTGCGGTATGCATTTCTC
TCCCGAACTTCCCTTTGTCTCAGCTTGCTGACATATTGCGTTTCAGCAACAACTTTCCCTCTGGGGCGAGAACTGTGACG
AAGATGTGTCGGATGTTACGGATAAGCTTGGTGTACTTCTTTATGAGATTGGCGAGCTGGAAGACCAGTACGTCGACCGT
TACGACCAATACCGTGTTACCGTCAAGAGCATCCGCAACATTGAAGCATCTGTGCAGCCCAGCAGAGATCGTAAGTCGCT
GCCCCGCCAAAGTATATTTTCCGCCCAATTTAACAGCAGACAGGGAAGCAGAAAATTGCCGACGAGATAGCCCGCCTCAA
GTACAAGGAGCCCAACTCGCCCAAGATTGTCGTTCTCGAGCAGGAGCTCGTCCGCGCCGAAGCCGAATCGCTTGTCGCCG
AGGCCCAGTTGTCCAACATTACGCGCGAGAAGATTAAGGCGGCGTACACGTACCACTTCGATGCCCTGCGCGAACATAGC
GAGAAGGTGGCTATCATTGCTGGCTATGGAAAGCATATGCTGGAGCTGATCGACGACACACCTGTGACGCCCGGCGAGAC
CCGTCCGGCCTACGACGGCTACGAGGCTAGCAAGGCTATCATCCAGGATTGCGAGGACTCTCTGACCAACTGGGTCAGCC
AAAACGCAGCCGTGTCTGCAAAGCTCTCCACACGCGCGCGCACGCTGTCCACTCGTCGCCGCAACCTTATCAAGGCGCGC
GCTGAGGGCAACGGCCACGACCTGTCTGCCCAGGACACGCCCCTCCACGACCGCGACCAGTGGGTCTCAGCCACCGAGCA
CAGCGATACTAAGTACGTCGACGAAGGCGAAGACGACGAAGACATTGAGGCTGAAGAAGAGGAGGACGACATTCACAGCC
GACACTCTGTGCTCGACAACGACACCAGCCTAAATGGCGAGAGCCGTGGCCGGACACACCAGGCCATTGCTGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62