GenePrediction:GLEAN_5231 Details

Name: GLEAN_5231
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1063467..1062261 (- strand)
Length: 1207
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1063467..1063348 (- strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_97:1063266..1063215 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_97:1063074..1062889 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_97:1062821..1062494 (- strand)
Length: 328
Type: CDS
Source: GLEAN
Position: GCSC_97:1062426..1062261 (- strand)
Length: 166
>GLEAN_5231 class=GenePrediction position=GCSC_97:1063467..1062261 (- strand)
ATGGAAAAGGTCAAAAAGGATTTCCCTAACGGCCTTCCAAAGCTTGCAGATCTTGCCATCCTCAATGCCGGCAAGGATGT
GCCACCCGAGACAGCTTGGATTTGGGGCAAGGATGATGAGGTGCGACGTTATATCCGTACATATAATATACTAGAGTGTG
TTTTCGTCTGCCGATGGGACTAACAAGGCTCCTGTTTCTAGCTCGGACGCATCAATCTTCTTACACCAGAGGTGGTGCGA
GCAGCCCAGGAGAGTGAGTTGAAAGATGGCAAACTCGTGTCCTTGAAGTGAGCTGTTCTTTTCGTCATGTTTTCCATTTC
TCGGTGGCGCTTCGTGCCGGTTGTTTCAGATATTGATTCAGTTGGTGCAGCTGGTCTTTGACCTGTCCGAGAGAGCCCTC
CTTCCACCGCGCTGCCTTTAAGCACTCCATCGAGGCAAACCCCCTTAGTACCTGCATCTTTGACGACATTTACGACCTGA
ACACCCAATCTGGGAGCCAGTGGGACGGCTTCCGCCACTTTGGCCATTTAGGCATAAACAAGATGTACAACAATCTCGAC
CCTAATGAGATTCACACTAGTCTGTCTGAAATGGGATACTTTCCCCCCTCGAGAACAACTGACCCTGACAGAATGGGTTC
ATCTAGGCACCCGATGTGGCATCCAGGCAATTGCACAGCATGGTATTGCCGGCCGTGGCATTCTGCTCGACTATTACTCA
TGGATAAAGAAGCAGGGCCGAGCATTTGACCCGGTTGCCGCACAGCCAATCCCTCTTGCAGACTTGAAGGCTGTCGCAAA
GGCTCAAAATGTCGAGTTTCGCCAGGGCGATATTCTCTTGATCCGCAGTGGTTATATTTCGCGTTATTACGAACTGGAAA
AGGAGGATCCGGCTCTACTTACGGAGCGGAGCAAGGAACCCTGCTTTTCGGGCGTGGAGCAAAGCGAAGAAATGAAAGAA
TTTCTCCACGATACGTGAGTAAATCCAGAGTCCCCATCTTTGTACTGAAACCTTTTGCTCACACTAGTTCTCAAATTGAA
GGTACTTTGCGGCCGTGGGAGGAGATGCTCCAGCCTTTGAAGTCTGGCCACCCAAAGCAGGCTACTATCTCCATGAGTAC
CTGCTTGCGCTATGGGGTTGTATCATTGGGGAGATGCTTGACCTAGAGGCATGTCACTCTGCTCTGTTTCCCAACACACT
TATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62