GenePrediction:GLEAN_5232 Details

Name: GLEAN_5232
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1039829..1037640 (- strand)
Length: 2190
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1039829..1039692 (- strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_97:1039616..1037640 (- strand)
Length: 1977
>GLEAN_5232 class=GenePrediction position=GCSC_97:1039829..1037640 (- strand)
ATGTCTCAACTGGGCGACCCGACGGACTTTGACTACGAGGCCATTAATTATATGTTTCGGCGAGGGCCGCCACGGTCATT
CCTCGATCGATTCAGTCCTCCGGCCAACACACGATGGATTTGTGACGGATGTAAGAAGGTGCGAGAATTTTACGGCGCGT
CCATAGACAGGACTGCCGAATGGGCGTGACAGCGTGGCTGACTGGCAAGACAGGAGGCATTACAGTCGGATACGCGATTC
CGCTGCCTCAGCTGCGATGATTTTGACTTTTGCCAGTCTTGCCACGAGACGGCTTTTGAGACGCACCCGCCACACGAGTT
TGCGGTCACTGACGGGTCGATGACGGCGAGGGAGATGGACAAGTACCTCTTGCCGTACCCAGACGCCGACAGCAGCAGCA
GAGCGGCCCCGGACGAGACTAAGCAGCCAACCCTGTACCCGTACCGGCCGCTGGACACGAGTCAGCACGAGATCCGGCTG
CTGGCGCTCCTGCCGGGTGCTGCGGAGGACGAGATCGCGTGCCGGATGGCCCACGCGCCGCTCTTTGCGAAGCTGTCGTA
CGAGGCGCTCTCGTACACGTGGGGCGACCAGACGGCGCCGGTGCTGATCCGGATCGACGGCGTATCCTTGGCGGTCGGGC
AGAGTCTGGCCGGGGCGCTACGGGCGCTGCGACAGACGGATGCGACTCGCTACCTCTGGGTGGACGCGGTGTGCATCAAC
CAGCGCGACGATGTCGAGAAGAGCCGGGAGGTGCAGCGGATGCGGCACGTCTATGTGCAGGCCACGGGCGTGGTGATCTG
GCTGGGGGAGGCCTCTCAGGATGACGCCTTCAGCAGCGACGACGCCATGGCGCTGGCCAACAACCAGACGCTAGGCACCT
TTATCTGTGGCACGGACACACACTGGGCAGCGCTCGACCGGCTGGTACGACGGCCGTGGTGGAGCCGGGTGTGGTGCCTG
CAGGAGGCGGCCGCAGCAGCTCGGCCTCCGCTGGTGCTGTGCGGCCGGCAGACGGCGTCATGGATCGGCCTGCACGATGC
CTGCCGCAAGCTGCCGGACTACTGGAAACGCACCAGGACGACGGCCGGCGAGGAATATGCGCTCGCGAGTGCCGATCTGA
CCTTTCAACGCCACTCCTCCATCCGCAACCAGTACATCAATGGCGAGCACTTCCGGCTGCTCTACCTGCTCTACATGACG
CTCGCCTGGGAGGCCACAGATCCGCGCGACAAGGTCTTTGCCGTCGTCGGCCTCTGTCGATCGGAAGACCGCGATGCCCT
GCCGCCCGACTACAGCCTCAACGTCCGCGAGGTCTACCTGCGCACTGCCCGTCACCTCATGACCACCAGCCTCAACCTGC
TCAGCCTCAACACCGGCTCACCCCGGCTCTACCCCTCTGCTGGTGCTGGCTGCCAGCGCCTGCCGTCCTGGGTCCCTGAC
TGGTCCCTGGGCGCGTCCCGGCCGCCGCCACTGTGGCGTGAGGGCTGCTACGCTGCCTCCAACGTCGCACCACACACACG
TTACTGGCCTGCCCTCATGCCCGGCGACGACCCCGACGTCGTCCGTCTCGTCGGCTCCCTCATCGGTCGCGTCCAGCACG
TCGGCGACGTCATCGTGGCCGATGCCACCAGCTGGGCTGCACCGGCCTGGACCGGCTTCTACGAGACCATCCGCAGCGTT
GAGACCTTCTTTCGCCAATGCGTGACCGCAGATGGTCCCGACATCGACCTGGACCGGCTGCTATACCGGACGCGCTTCGA
CTGGATCTGGAGGACGCTGATCGCCGACAGGGAATATCCGCAACTCTCGTGGTCTTGGCCCGCCTCGGCCGATTTCGCTG
CGGCCTACCACTACCACCGGGAGCGTGCCTGGGGCCGAGACACAGGCAGCACCGAGGAGAATACCTACCATCGCCGCGCG
TACCCTGTTCTGGCTAAACACACGCTGAACGAGCGCCGCGTCTTCTTGACCAGAGACGGGCTCTTTGGTGTCTGTGCCAA
GAACGTCGAGCCGGGCGACGTGGTCGTCATTCTAGCGGGAGGCGACATGCCCTACATACTGCGCCCTACACCGGCTGCTT
CCGAGCCAGACAAGGAGGCCTATCTTTTCGTTTCGGACGCCTTCGCGTATGGCGCTATGGACGGACAGGTTTTCCGCCTC
CATCCAAATACGGAATTTCCCATTGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62