GenePrediction:GLEAN_5239 Details

Name: GLEAN_5239
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:990619..987643 (- strand)
Length: 2977
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:990619..990402 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_97:990340..987643 (- strand)
Length: 2698
>GLEAN_5239 class=GenePrediction position=GCSC_97:990619..987643 (- strand)
ATGGCATTTCGCTTTGCCATTCCGATGTCCCAGGCAACGGATGGGAAGACCAACCGGGATGAGGACGGTCTAACAAGCCA
ACTGGCGGCTGGCCGCAATGCGGCAGACATTACGCGCCAACCGTCTCCGGAGCCGAGGCAGCTGAAGAACAAAGCGTCAA
GCTCGGACGACGCCCACCGGCGCCGACACATTGTTACGCCGGACCCGGTGGCTCTGATGTACGTCTATAGCTCTGGGCTG
GCGGCGTTGCCTTTCCAAGTGTCCTGCTGACGTGGCCAGGTATCTGGAAGGGGATCCTTCTGTGAGCATAGTCGAACGGC
GAATCAGCCTCGAGGGCTACGAGCTATACCTTGTCGAACAATGGGCATGCTCCCGGCAGTCGCCCACGCTCGTCATCTCG
ACGTACACGGGCGATCCAAACCACTCGGTTGTTGTTGGAGTGCTTTCTGCACCGGCAGATGAGCAGGAGCGGTCGCCACG
GCTGCGCATATACTTCAGGGCCATGCAGCAGTATCATGCGCGTCCCAAGGAGACGCCCTTTGGCGAAATTATGGCGACAA
ATTTGAGCAGCTTCCCGTCTGCCTTGACGGTCATTGCGGTGCCGGATGGCGATCTGAGAAAGCATCGGCAGGACTTTATC
GTCAACGAGGACCTGAAGCGACTCGGCTGCTCCGGGCGGTCGGCCCTCACTCTACTCCCGCCAACACGGGCGACCCAAGA
GACGTTCTTGTCACTGTACAAGACGAGCGACAAGATACCCTTTACAGAGTCGGTGGTGGAGTTGATAAAGTTATGCCAGA
CTGCTTTGTGCATATTCGGGATGCTCGGCATACAGTACATGGACGGACTTCTCTGCGACCTGACGGAAAAGGCGATCAAT
GACTGGTGGACGGAAATTGGGGCAGAGTGCTACAACGTCGAACCAGCAGACGGCATCCTCGGGCCTACTACGGTGGCGGC
TCTTCTCGGCATGCTGATGGGCGCGCGAAACCGGCTGGCCTGGTATGGGGCGCCGGTAACCAAAGATGTCTTTGATATCG
AGCAGACGAGCAAGGGCATTGACTACTTTCAAAAGGCACACAAACTCAAGAGAACACGCCGTCTCGACCACCTGACACTG
CGGAAACTTCACAGCGTGACAGCGAAAGCTGCGGCTGGTGAAGTGGGCTGGGGCGTGCAGAAGGCAGTCAAGTCTACGGT
CGAGGGCTTTGGCGGCAAGCGTGGCGAGCTTGTGATCGGCATGGTGGGCGGCAAAGACAAGGGCAACATCGGGGACATTG
AAACGGTTGATATTGACAAGTTTATCGGCCTGATCTACAGCGAACGGCCAAAGTGGCTATGGTACGGAAAGCCGCGGAGG
ACGGCAGCGACGACGTCCTCGGGGACGGACTATCGGATAGAGAGCGACAATCTTTTCAGCAAAGAGGAGGGATCGGCACC
GAGCAGCCGACAGGGGCTTCCCCAGAGCCAGGAAGTGGAGGAGATTGCAGCGGCGGAGGCGGACAACGCAGTGCAGAAAC
GGGAAGACCGGTCGGCGGTGTATTTGGGCGCGGTGCCCGAATCGGCAGTTAGTATCAACGACAGTCAGGGCGACAAAGAC
CGAGACCGGGATCCCAGGCGGCGGACGGTGTTCAAGAGTGTGGCGGGAAGAGTCAGCGATGCGCGGTCAGGCTTGGGACG
GATACGAGATGCTGTTGGTGGCGGTCTTCGTGGCCATGCGAGTCGGACATCACGCGACGAGGCGCCACTGGGCGGATCTG
TGGGACCAGGCACGCTGACGGCAGCATCTCTGTCTGGCCCGACGGCATCTGGTATTGCGAGCCTGGCGCAGTCGTCTGCG
GTACTCTCCAGCCCAGTGCTGATCAGCCGTGCGTTTACGTGGAAGAACAAGCCGGAAGAGTACGCCAACGTGTTCCGGAG
AGGAGGAGAAAAGGAACTATCGGCGACCAGCCTGCCGGAAGAGGAGGGAGCAGCATGGACGGACGGGGGGCGGCTGCTCG
ACAGAAGCACATATCCAGACCCAGAGGATCCACAACAGGGCCTCCCGTGTGTGGCAAGCCCGTTGGTCATGACGCATCGA
CCATCAGTTCCTACGTCCGGAGCGGTGTCTGGGCTGAGGACATTTGCACGAAACAGGACAAGCCAAGTGTGGCGTGGGAT
GGCAGCGACGACGGCAGCATCAGTGGCAGGGTCAGTTGCAGACGAAGCGGACCTGCAGGGGCCGTTTCTCGAGGCGGAGC
GAACGGTTGGAGCGGAGGTGGTCGGGCTGCTGCGTCGCCACAGCATCGCGGGAGGCTTTCTGTCACGATGCGAAGAGCGG
CGACAAGTGGAGGCGAACTGGCCGCGACGGCTGTCGTTTAGCGTTGCAGAGGAGGCTGTGCTGGGATGGGAGGAGATCGT
GTCGGGCGTGGCCTCAGCGGACTCGGCAGACTTGGAGGAAGCCGAGGAAGCTGAGGACAGGGAGGCGGACGGGAGTGCAG
TGGAGCGGATGGTGTCACGACACATGGCATCGCTGACGCTGAAGAGCAGCCTGTACGGGCAGATGCGGTCGGTGAAGGGG
GGGCTGGGGCTGTCGGTGACGGAGCGGATTCTGGGGCTGGAGGCGATCGACGACGCGTACGCGCAACAGGTGGAGGAGGT
GCAGAGTATCTACTTTCAGCTGTCGGAGGCGTGTGAAGGGGTGCAGCGGAGCAGCCAGGAGCTGCTGGGGATGGAGCGAG
CGCAGGCGTCCGAGGCAATTCGGGAAGTGGAAATGTTGACGGCCAAGGTGGAGTACGAGATTGGGGCGCTGATATCGCGG
GTGCAGGAGGTGGAGGAAGGGGTGCGACAGTTTGCCGAGCAGGTGGAAGGGGTGGAGCAGCGGGCAGAAGAGCTACAGAA
GCAGCTCGAGACCGAGAGTTGGCTGCATTGGCTGGTGCGCACGCTGACGGGCATTGGGACCGGGCCTAACATTATCCAGG
ACCTGCGGCCGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62