GenePrediction:GLEAN_5241 Details

Name: GLEAN_5241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:979524..977623 (- strand)
Length: 1902
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:979524..979393 (- strand)
Length: 132
Type: CDS
Source: GLEAN
Position: GCSC_97:979324..977890 (- strand)
Length: 1435
Type: CDS
Source: GLEAN
Position: GCSC_97:977786..977623 (- strand)
Length: 164
>GLEAN_5241 class=GenePrediction position=GCSC_97:979524..977623 (- strand)
ATGTCAGAAGGGCAGCCGCCCGCAATGCCAGCGGCTGCAGCGACGGACCTCTACGGATTCGGCGGCGCCGTCGATCGGGC
CAACCAGATGGTGGATGGCGATGCGACGCCGCGGCCGAACGCCGCATTCACGGTTCGTTTGTGCTCACCGCTGCTCCTGT
GCCCGGCCGACTGCTGACTGCTGACCGCTGACCGCTGCAGGGGTCCCAGGACGAGGCCATGATGTTGCTGTTTGACGACC
CGTCGTCTTTCTTCGGCGGCTTCTTTGAAGATTTCCAGCAAGCGCCGGCCTCACCGACGGCGGCTACGGACACGATGCCG
ACGACGATATCCCTGCATATGCTGCCGCCAACGGCTTTTGACAACGACAACGACGGCAGCAGCCCGACGACGGCCGAGAG
CAACGGTAGCGGTAGCAGCACGCTGCTGGTCCGGCCGGCGGTGTCGGCCATTGAGGGTCCTGGCGCGGGGCCGCAGCCGG
CGACCGAGTTCGAGCAGCAGGGCCCGGCGGCGAGTGGCAGCGCCCTGGCCGAATTTACACGGCGCAAGAACTGGCCGGCC
AAGATCGTCGAGGAGCTGCGCGACCTGCTGATGGTGATCGATCCCAATGGACGGATCCGCTACGTCACGGCACGGCTGCC
GGAGCTGCTCGGCTACTCGCACACCGAGGCGGTCGGCCAGATGCTGACGGACCTCGTCCACGTCGACGACCGCTTCGTCT
TCATGTCCGAGCTCAATGCCTGCATCGCCAATGCGGCGCTGCTGCGGCTCTACTGTCGCATCCGCCGACGTGATGGATCC
TATGCCGTTGTCGAGACCGTCGGCCACGCCCATATTGCCGAGTCGCGCTTCGCGCCCAATCCGGCCAACCAGTCGGCCTT
TTGCCAGGCTGTCTTCCTCATGCTGCGGCCGTACCCGACCAAGAACGCGAGCCTGCTGGACTCGTTCCTCGAGCATAAGA
TGGAGAACGAGCGGCTGCGCCGCCGCATCGACGACATCCGCCACGAGGAAGCTTCCGAGGACCACGACATTCATATGCAC
AGCCACGGCCACAACCACAACCACGGGAACCATGACAGCCACGACCACCGCGATGGCCACTCGCGTGCCCATAGCCTCTC
CAGCCTCTGGCGCCACAGCATCGGCTCGCGCTCCGACCTGGCCACCTCCGACGCCGGGGCCGGCGTTTTATCCATGCAGA
TGGCGCCTCCACCACATCCCATGAGCATGGGCACCTCCACCAGTCTCAACAATGCCGCGCTCACCCGCGAAAACCTCGAG
GGCATCGCAGCCCGACGGCCCGATTCGCTCCGCGACAAGATGGAACGTTACAAGGGCGTGACGGCAACAGCGGCTCCATC
CAACGGGTCCACGGCCGCTCCTGGCGGCTCTGGCGAGAAGACTGCGCGCCAGGCTGGACCCATGGGCACGGCCACGCACG
CCGATACCATCGAGATGCTCACTGGCCTACGCTACCAGGAGGGTGAGCGCAGCAAGGGCCTATCGACAGGCAACCGGAGC
CCGCAGCTCGTCAAGGGCGACGTAGGCATCGCCTTCTCGCTCAATCGGGACCAGCGGGCCGGCGAGAAGAAGAAGAAGAT
GCGGCTGGCAGAGGAATACGTCTGCACAGACTGCGGTGAGCTGCTGTTTTGCTTTCCTCTTGTTTCCCTCTCGTTCTCGT
CCCTGCTGGTTCAAATGCCACAGCTACCTTACCACGATCACTATGCTGACAAGACCAGGAACCTTGGAATCACCGGAATG
GCGCAAGGGACCTAATGGTCCCAAGACGCTGTGCAACGCTTGTGGCCTGCGCTGGGCAAAGAAGGAAAAAAAGGAAAAGA
AGAGGGAGCAGCTCGCCGAGACAGCGGTAGGGCCACAATCACCCACGCGGAATCGGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62