GenePrediction:GLEAN_5242 Details

Name: GLEAN_5242
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:976955..975929 (- strand)
Length: 1027
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:976955..976919 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:976561..976376 (- strand)
Length: 186
Type: CDS
Source: GLEAN
Position: GCSC_97:976308..975929 (- strand)
Length: 380
>GLEAN_5242 class=GenePrediction position=GCSC_97:976955..975929 (- strand)
ATGCGGGGCGACGACGATTACGAGGGGCAGCAGTCTGGTGAGTAATAGCTACGAGTTGGGGCAGCTTTTCTTTGACAGTC
TACCGTGTCCAGAGCAGTTGCCCAAGATTGGACTGCCAACCGGCTCATCTCATAGCTAACCAAACACAGGCCAGCAGCAG
CAGTACGGCGGCGGTCAACAACAATACGGTGGTGGTGGCCAGCAACAATACAGTGGTGGTGGCCAGCAGCATGGCGGTGG
CAATGGTCAGCAGGAGTATGGCGGTGGCGGTAGCGGTCAGCAGCAGCAATACAGCGGCGGCAGTGCCCAGCAGTACATGT
CGGGTGGAAACAGTAGGTTGACCACGCAGTCTTGATGACGGGACATGAGTGCCGGGTACTGACGAGCTTCCAAGCGACCC
ACGGTGGCAGCTACCCTGCCGGCGGCAACTACAACCACGAGGACGACGAGGACCTGAGTGGCGCTGCTTCGGCAGCTGCC
CAGCACAGCGGCACCGAGGACCGCGGCTTCTTCAGCGACATCCTAAACCAGATTGGCCAGAAGAAGGGCAACATTGCCAG
CGAGAGCGTTGATGAAACTGGTATGTCACCTTCCTTGGCCAGGCATCCTAGGCCTCCTCTTCTTCTTCCAGGCTGACAGG
AAATTAGCCGCCGTGCAGAGCCACCAGAACTACTACGGAGGCCAGAGCAGCGGTGATTCCGCCACATCGGGCGGCATGGG
CATGGCTGCGGCGATGCAGGCGCTCAAGATGTTCAGCGGCGGACAGTCCAGCAGCAGCAGCGGTGGCCAGAGCCAGAACC
AGTTCATCGGCCTGGCCATGAGCGAGGCCAGCAAGCTGTTCGACAACCAGGCGGCACAGGGCAACGTGGCGTCGGGCGCG
AGCAAGCAGTCGGCTGTGCAGCAGGCCGGTGAGATGGCGCTCAAGATGTTCATGAAGAGCCAAGGAAGCGGTGGCAGCAG
CGGCGGCAGCAGCGGCGGTTCTAGCAGTCTCAGTGGACTTCTGAGCATGGCTAGCAAGTTTATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62