GenePrediction:GLEAN_5244 Details

Name: GLEAN_5244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:963551..958586 (- strand)
Length: 4966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:963551..961656 (- strand)
Length: 1896
Type: CDS
Source: GLEAN
Position: GCSC_97:961584..961372 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_97:961276..960287 (- strand)
Length: 990
Type: CDS
Source: GLEAN
Position: GCSC_97:960165..959982 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_97:959915..959231 (- strand)
Length: 685
Type: CDS
Source: GLEAN
Position: GCSC_97:959156..958586 (- strand)
Length: 571
>GLEAN_5244 class=GenePrediction position=GCSC_97:963551..958586 (- strand)
ATGCCGCTATCGTGGTCCGGCCTTGTCACGGCCGGGCTTGTGGCCAGTGCCGCGGCGGTTCATAGTAACCTCCGGCAAGC
AGCTAGTCCGAGCTATGCTGGCCACAACGCCTGCCCTTTGTCATGTGCCGAGTCGGGACCCAGCCCGGCCAACTGGACAG
CATACGGCAATATCAAGCAGGCGCAGCGGTGCCAGCAGACGGTATACTACCACTTTAACATCCATGGCAAGGTGGACGAT
GCCTCGGCATCACAGCTGGTGTTTGCTTGCACTGCTGACGGCCCGGCCGCATTTTCGTCTCTTCCCTCAGACGCCACTAC
GCACAAGACCTTTGCTGCCGAAACGACGACGCTGGACGCGACATATGCCGTGACCCGCTGGGCGAACTTGGCAGCTACCG
GGGCTACAGAGGACCTGCGCAACACAACAGACAGCATGCTCGGCTTTCTCGACAACGGCTATGGCACGACATCGAACACG
TCCGCCTCGCCCTTCATCTTCTTTGCGCAGTCGCCCGGCTCTACCGTCGGCATGTACATGGGTCGGGCCGTAGACGGCGT
GTCTACCGGCACGGCAGCCCTGGAGGGTCTGCTGAACCTGCTGGACGACCACTCGGCGGCGGAGTATAGCGGTGTGGCCA
TGCAGCTCTGCGGCTCCTTGTTTGATGCCGACCACATGGTCGGCTATCTGGCCACAGCCAACCGCTCTTTTGACGTAGTG
CAGGAGGCGCTCCAAACTTGGGACAACGGAACGTGCCTGCCGTACATTGCGTCGGAGTCGTTCCGCACGACGGCCTCGTT
CACGTCTTCGCTCCTGTCCAACGACACTAGCAACTCGACCCTCAATTCGCGCGCTGCTCCCTATCATCGTAACGGCCGGT
CCTCGCAGCTGGTGGCTCGCGACGACTGCACCGCCATCAAGGTCGTATCGGGCGACTCCTGCTGGGCGCTGTCCCAGAGA
TGCGGCATCTCGGCAGCCGACTTTACAAAGTACAACCCGGAAGCCAACCTATGCGCGACACTTACGCCCGGTCAGCATGT
CTGCTGCTCGGCCGGCACGCTTCCCGACTTCAAGCCCAAGCCCAATGCGAACGGGACGTGTGCCACGTACACAGTGGTGG
CAGACGACTCGTGCTCGGCCATCGGTGCGGCCTACGGGCTGACAAACGACGATATCGAGGGCTTCAACACCAACACATGG
GGCTGGAATGGCTGCAGTCTGCTGTACGTCGGCGCCAACATTTGTCTCAGCTCTGGCGACCCGCCGATGCCGGCAGCACT
GGCAAACGCCTTGTGCGGCCCGCAAAAGCCTGGCACGACCGTCCCAACGTCCGGCACGCACAACCTCAGCAGCCTGAACC
CGTGTCCGCTAAACGCCTGCTGTGACGTGTGGGGCCAGTGCGGCATAACAAAGGAGTTCTGTACGGACACAAATACTGGA
GCGCCCGGCACGGCCATGTCCGGCACGAACGGATGCATCAGCAACTGCGGCACAGATATTGTGCAGGGCAGTGCGCCAGC
ACAGTTCATCAAGCTGCAGTACTACGAAGCCTTCGGCATGGACCGTGATTGCTTGTATCAGGACTTGTCGCAGTTGAACC
TTTCGGAGATGACGCACATCCACTTTTCGTTTGCGTCGATGGACTCGGACTACCAGATTTCAGTCGGCACCAGCGAGTAC
GACAAGTACGAGTTCAATAGCTTCACCCGTCTGGGCGACAGCGTACACAAGGTGCTGACTATTGGTGGCTGGGCCTTCTC
GACTGGCTTGAGCACGTACCAGATCTTCCGTGATGGTGTGAAGCCAGAGAATCGCGAGGCCATGGCTAAAAGCATCGTCA
GCTTTGTGACAGACAACAATCTGGATGGTATTGACCTCGATTGGGAGTATCCAGGGGTGAGTGTAGATAAGGGCCGGCGG
CAAAAGATAGGGTTCTTTGATCATCTAACCTGTCTATTGTCTGATAGGAGCCCGACATTCCAGGAATTCCTGCAGGTAGC
AACGACGAGGGCGACAATTACTTGGAGTTCCTCAAGGTGCTTAAGAACATGATGCCAAGCGGGAAGACTGTGAGCATAGC
AGCGCCGGCTTCGTACTGGTACTTGAAAGCGTTCCCGATCAAGGATATTTCAGACGTTATCGACTACATTGTGTTCATGA
CGTATGACTTGCACGGACAAGTGAGTCTTTTCTTTTTTTTTTTCTTTCTTTTTTTTTTTTTTCTTTCTTTTTGTTCCCCT
CTTCATTTTCCCTCCAGCATTTCTAACTACCCTAGTGGGACGTGGGCAGCAGCTGGTCTCAGGAAGGCTGCGATAACGGC
AACTGCCTACGCAGCCACGTCAACCTGACCGAGACGATGACGTCCTTGGCTATGGTGACCAAGGCCGGCGTGCCCTCCGG
AAAGGTGATTGTGGGTGTCAGCAGCTACGGCCGTTCTTTTGCCATGTCCACCGCCGGCTGCTACTCGACTGGGTGCACCT
TCACGGGCACATCGACGGTCTCCTATGCCACTGCCGGCGTGTGCACCAACACCTCTGGCTACATCTCGGACGCGGAGATC
TACGACATCCTCGACGGTACCGACGGACAACACCTGCGGAGAGCGGAGGACGGTGGTCATCGACGCATCGACCGCAGCCG
CCGGCGCAGCGTGTCATCTCGGGTCAACCAGTACTTTGTCGACAGTGACAGCGATAGCATCATCATGGTGTACGACGACA
TCCAATGGGTCGCCTATATGGACAACGACATCAAGAAGGCTCGCAGCAGCAAGTATGCCGGCCTCAACCTGGGCGGAACC
ACCGACTGGGCCAGCGATCTTGAGACCTTCAATACCGCTCCCAACAACTATGCCAACTGGGCCGCTTTCCGGGACGCCGT
CAAGACAGGCAACTTTGCTGGCGCAGGCTCCAACTCCATGAACCGCACCGGCAACTGGACTGAGCTCACCTGCACCACCC
CGGCTGTCGCCGACGCCGACAGCATCACCGCTGCCAATCGCTGGCTCGACCTGGGCTGCCCAACAGCCGTGGAGGAGGCC
GTCCAGGCCTGGGCTGCCCAGCTCGCGGCCAATGCGGACAATTCCAACCAACATTTCACGTCCACCGTCGCCGACTTCTT
CCACCTAGGCGAGAGTACCAGCTGCGGCGAGATGTCAGCCACAGGCTACTGCACGTCGCCAATAACCTGCCAAGCGGTCG
CCAATGTCAACGGTTCGGGACCAGCTGCGTACGAGATCTGGAACTCGTTTGTGTTTCTGCATAATGTGTGTGCACGTTCA
CTCCTTGTCCTCACGCAAGGCTGCTGGGAAGACCCTTCTTCTGCGGCAGTCTCTCCACGGCAGTCCTCTCCGATGTATTT
CACTAACAGATATTGTTTTATTCCAGCTTTACTACAACCACTGGTTCATTATCGAGGACATGGCTGCAGTCGACATCGGC
CTCCATCAAGACGCTTTCGTCGACACGTTTGCGCCCATTCCGCCAGATAATACACAGAATATCCTTAACCTGATTTTGGC
TTTTGTCGGCCTCGCTGGCACTGTTGGTGTCTCCTCTCTTTTCAACTCAGGTGAGTCTGGTCCCCCTTGGAAGGACATAA
AGAGATAGCGTGAAAACCAGCTGACCGTCTCCCCAGTGCTCAAGAGCCTGCCGTACTTCACCACCGACTTTGGCAAGGTT
GCCTTTGACAACTACAAGGACATTTCCTTGGCTCTGGTCAGCTTTGGTGTCTCTGCCAGTGGCGACTACATTCAAGCCAA
CCAGGCCAAGTGGACGGCCGAGTCCCAGGATAGCTTCAAGTCCTTTATGGGTGACACTATGGTAGCCTGGCAAGACTCCA
CCGCGAATACGCTGAAGGTGCTGTTTAACGGCGAGCCCGACAGCCTGTCGCTGCTGCAATCGGTCATTGCTAATGGCCAC
TTCATCGCCGGTGGCGATCCAGAGACGCATATTCTCTCATCCCCTGGCTATACCATCGACGACGACGACGCCTCGTATAT
GCGAGGTAACGTCACCCGCAGCTACTACGCCTACATGATTCCCTCTATCTGGTCGGCCGTGGGAGACAATGCCTTCGTGT
TGGACACGCAAAAAGGCTGCGACGCCGACCGGTCTACTGTCTATCTGCCAGATGACGCTGCGACCTACTGCTACGACGGT
ACGATGTACGGAATTGTTTACCCGCACGGCTATGCCCAGTCATGCTCCAGTTCCGAGACCGGAAGCGTATGCACTAAGAA
AGCCTTTTCCAATCCCCCCGGCATCGATTCTCTCGACGGCACCCAATGGGGTGGTGTGACGGTTGAGGACTTGGTCGTCG
GGTAAGCACCTTTTCAGCATCCTTTCTCTTTTCCAGCTTCCCATTCTGTTCTCTCCTTCTGACACAACCGACTAGCTCTG
TCCGCACCTATATGCAGAACAACAATCAAAATGGTGGCCGCACCGCCGATCCGAGCGATCCAGGGTCGCTCGAGGACCTC
ATGAATGGTGACATCACAACGCCGGGCTATATCATCATGCCCGTGTGCTCGGCCGAGTACGCCTGGGCAAACTGGAAGGC
TCACGGCGCCAAGCCGTCGGGCGTGAACTACTGGCCATGCGGCGTCTACCCGTCGCCCAATGATTGCCAGACCTCGTCAT
TTACCGACCAGACCAGCAGCGCCTCGCCGACTGTCGAAGACTGCATGGGCATCGCCAACAATATCAGAGGCACTCAAGGC
CAGTGGACCATTCAAACGGCCGGCAAAGCGCAGCACAAGATCGCGTCCTATGGCAACTGCAAGTTTGGCGTCCAGGCTAC
CAACCTGCACGGTGATATCAGCTTCAAAGTCGGCGCTCAAGACATTGTCGACATCATCACCAATGCCGTCAGTCTTTACG
GTGCCAGCGGCAAGATTGGGGCCAAGGGCTATATGGACTGCGATGGCAACATCAGCACGCAGGACATGGAGTGGGGCATC
TACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62