GenePrediction:GLEAN_5246 Details

Name: GLEAN_5246
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:943427..941714 (- strand)
Length: 1714
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:943427..943356 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_97:943187..943151 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_97:943086..942985 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_97:942931..942653 (- strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_97:942599..942535 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_97:942479..942134 (- strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_97:942042..941920 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_97:941865..941714 (- strand)
Length: 152
>GLEAN_5246 class=GenePrediction position=GCSC_97:943427..941714 (- strand)
ATGGGTGCCCGTCTGCACAATGTCCGCGTCGCCGTCTGGGGAGAAGCGCCCGAGACCGCCGAAGAACGCAAGGTCAGCCT
AGTTTGATTTTTTAAGGTTTAGTTTGCCAGTTTGCCGGAGTCAATGGCTGACAAAAGACTCAGCTGTTACGTAAAATCGA
TGCTGCAATTCTGGTAAGCTTCCACTCAGGTGCGGGGATGGATTGACATCGCGATCTGACGAGTGCTGTCCACTCCGTAG
ACCTACTGTTGCGTCGCCTACTTCTTCAACTATCTCGGTAAGGCACAGCCGGGAACAGGACGTCTATGGATGGTGGCTTC
GGCTAGCTGACTAGGTTTCAGACCGCGCCGTCCTGGCCAATGCCTACGTGTCGGGCATGAAGGACGACATCCACCTCAAG
GGCAACGAGTACCAGCTGCTAGTGACATGTCTGTCTGTCGGATGTATGTCTCCCAAAGCCCCTTTGCTCGTGCGGCTGCC
GAGACTGATGACATAGACATTATCGGCCAGGTGCCGCACGGGCTCGCCATCCAGAAGATCGCCCCTCGCATCTGGTTCCC
CTCCATGACGCTCATTTGGGCCTGCCTCACCATGGCCAGTGCTGGATGCAACTCGTTTGGCTCTCTAGCCACCGTGCGCT
TCCTACAGGGTATCTTTGAGGCCTCGACCTACAGCGGCACGCAGTACGTCATCGGCAGCTGGTACAAGAGCGCCGAGATT
GGCAAGCGGGTCGGCCTGTTCCAGGCTTCGGGCATGGTCGGGACCATGTTTTCCGGTAAGCCGCGCGCTCTGCAACCCGT
CCGACCAAATTTACGGCTGACGGACTAGGCGTAATGATGACGGCCATCTGGAAGACCATGGACGGAGTGTCGGGCATGGC
CGGCTGGAGATGGGTGAGTGAGAGCAACACATGCATCAAAGTCCTGCCGACTGACTTTAGTCGCCTAGAGTTTCATAATT
GATGGAGTGATCACCATTCCAGTGGCCATCTTCGGCTTCATTTTTTTCCCCGACCTCCCCGAGACGACGAGCGCGTTCTA
TCTCAAGCCGCACGAACGCGAGCTGGCCGTGAACCGGCTGCCGCCCAAAAACCCAGACGGCCACAGGATCGGCTTCTCTC
TGGTCAAGCGGGTGCTCTTCACGGCCAATTTCTGGATCTTTACCATATTCTGGGTCATTGGCGGCGCCCTCGAAGCGTTC
ACCACGCAGTCATGCATGCTTCTCTGGATGAAAGCGTCCAAGCTCTTTTCCGTGCCGCAGAACAACACGTATCCGCTGGG
CATCACCGCTGTCGGTTCGTGGCCTGTCCCGTATGTCGGACAGAGATTGTACAGAGCTGACAGGATGGCGCACAGGAATC
GTCGTCACACTTTTAACTTCCGTAGCCATCGACGCAACGAGAAAGCACGCTCCGTTTGGCTTCTTCGCCTGTGCTGTCCA
GATCATCGCCTGCATCGTGCTCTTGTGCTGGAACTCTATCGGCATGGGAGGCAAGATGGCCGGCTACTGTAAGTCCGAAT
CCGGTGGCCCACAGATATGGTCGAGAACACGCTGACAGACAGACCTGGCCGGCACCGCCTACATGATCCAGCCAGTCACT
TTTATCTGGGCCAATATTATTCTCTCGCGAGCTGGAGATGACGCGGCGCGTGCTGTCACCCTCTACTCTATGAATGGTGC
GTACGGCTTGCCCATCTTGAGCGCCAGATTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62