GenePrediction:GLEAN_5247 Details

Name: GLEAN_5247
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:941097..939450 (- strand)
Length: 1648
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:941097..940868 (- strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_97:940815..939450 (- strand)
Length: 1366
>GLEAN_5247 class=GenePrediction position=GCSC_97:941097..939450 (- strand)
ATGTCATCTCCAGAAGAGATTAGTGACCTCAAACGAGAGCGAGTCCACCCGCAGACACCCAGCCCAGATGAGCAGACAAT
GCTGCTGTCCATTCTGGACGCAACGACGGCCAATTTTGCCTTGACCAACGCCATATGGTTGTTCGAGAGACCGAAAGGAA
TGGACGTATCTGACGTCCCAGGCCATCTCCGCCGGACTCTTAGCACTACGCTAGACTCTTACCCCCAGTGGTGCGGTCTC
CTGCAGTCAATCGACGTCATTGACAATGACCAAATTCCCGAGGGCGCAAAGGGATTTCCAGCCCATGGCCGCCGATTCGG
AAGGGTGTATATCCGGTTGCGGAGGCTCTGCAGAGGTCGGCGTTGACTTTGCTACTGCCGCCAGTTCCCTCACCCTGGAC
TCACTTTATTCCAGTGAGAGGACAAAGACTCAGCCGCTCTGGAATTGCAAAGATAATGGGATTGCACGCTTCATCAACAC
ATGTGACATTGCACATGCTCTACAGCCTAATAATCTCGATGCCAAGACTGGCATTAGGAAACCCATCATGGGCATCCAGT
GTACAATGCTTGCGTGTGGCGGATTTGTTCTGGCCGTAAAGATTGCGCATCCGCTGGCAGACATTTCTGGTCTTGTCTAC
TTTGTCAGCGACTGGGCAAGGGTGAGCCAAGCTATCGTGACTGGCTCTACACTACCCGTTCTCAGCCCTGTATTTGAGCC
GGCCAGGTTAGATGAGGTAGCTGCTAGCGACATCAATAGCCATCAGCCGGACCCTGCTATCGTCAAGAAGACTAAAGCCT
TATTACTGCACAGATACGACTGGTGGGCACCACCTGGCAAGCCTCCTGCACCGTTTCTCGACGAGGCGGACTCGTTAACC
CCGTCGGGCCAGCCTATGCCTTGGGAAGAATGGGATGTTAAAGCCCCTGTCTCAGGCTATACCATCCACCTTACCAAAGA
GCAAGTTGAGCTCTTGTGGAAGGATGCTACCACGGGAGCTGAGAAGGGGGGACTCGTGATCAGCAAGCATGACGCTGTTT
TAGCTCATATGTACGCATGCATCATGCGAGCTCGTCGGCTTCAAATCGACGAGGGCCCCGTTCATTGCGACCTGGTCCTC
GGCCTTCGCTCTGCCTTGAAGTTGGGTGAATCATTTATGGGGTCTCCAATCATTATGATTAACGTTGAAATGTCCGGCAC
AGAGGCCTGTTTAACAGAATGTTTAACAGAAGGAAAGCCCACGGGACTGCTGGCACCTATTGCCAAGAAAGTAAGGGAGA
CTATAGTTACAACAAGCAATCGGGATAACTTGTCGGCACATCTTCATACCGTGGCCTTTGAGAAGTCTCCCCAAAGATTA
TGGCAGGCTTTCCTCGGTCAGCGACATATTCTGGTCACCACGTGGGCTCGCGCTGGTCTTTACGATGTTGACTTTGGATT
GGGATCGGACATCCGATACGCGGATGGCCTTATGCCAAGCCTTGATGGAGTCGTATTCATCAAAGAGGCACCGCCCTCAT
CTGGAGGATTCGTGTCGGCATCTAGACCGTCTTGGACTTCTGACGGTGTTGATATAGGTATTAACATCAAGACAGAAGAC
ATGGAGAGACTGTTAAAGGATCCGCTGCTACTTCCAAGTTGTCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62