GenePrediction:GLEAN_524 Details

Name: GLEAN_524
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:351065..351840 (+ strand)
Length: 776
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:351065..351663 (+ strand)
Length: 599
Type: CDS
Source: GLEAN
Position: GCSC_97:351717..351840 (+ strand)
Length: 124
>GLEAN_524 class=GenePrediction position=GCSC_97:351065..351840 (+ strand)
ATGGCCCTCTCCGGCAAGCATGTCGTGTTCGATATCGTCGGCACCTGCGTGACGTACGACGCCTTTTACGAGGCCGTCGA
CGCGCGCATCGGCGACCGGCTGCGTGTTCACGGCATCCGCCCGCGCCACTTTGCCTTTACGTGGATGATGGAGGCTGAGC
GCGAGTACAGCTATCTGGACCGCAGCGGCCGCTACGTGCCCTTCTGGACCGTCTTCCCGCCGCTCTTCTTCCGCGTCCTC
TTCCAATGCGGCATCGAGGACCCGCGGACGCTCTGCACGGCCGACGACGCCGCCGTCTGTGCCGCAGCCTACCGCACGCT
GCGCGCTCGTCCCGGTATCCTCGAGTGTCATGCTCGCCTGCGCGCTGCTGGCTTCACCGTCTGGGCCTTCACCTCGGGCG
ACGCCACCCGCGTCCAGGGCTACCTCGCCGCCAACGGCATCGACATCCCGGCCGCCCACTTTGTCACCTGCGACTCCCTG
CAGGTCGGCAAGCCGACGCCGGAGGCGTACCGCCACGTGCTTAACCAGTTTGCTGGCGCTACCGAGACCTGGTTTGCAGC
CGCACACATGTGGGACACAATGGCAGCACAATGCAACGGGTAGGTCAAGTTCTTCTGTTCTTGTCCTCTCCTCCCAGCTC
ACCCACCCCCAGATTCAAAGGCGCTTGGTGCTCCGTCTACGAAAAAGAACCCGTCACAGAGGTCTTTGGCACCCCTCTCG
TCATGGCCGACTCGCTCGTCGAAATGGCCGACAAGATCATCGCTGCAAGCACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62