GenePrediction:GLEAN_5253 Details

Name: GLEAN_5253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:889781..885549 (- strand)
Length: 4233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:889781..889660 (- strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_97:889552..889477 (- strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_97:889388..888843 (- strand)
Length: 546
Type: CDS
Source: GLEAN
Position: GCSC_97:888702..887600 (- strand)
Length: 1103
Type: CDS
Source: GLEAN
Position: GCSC_97:887367..885549 (- strand)
Length: 1819
>GLEAN_5253 class=GenePrediction position=GCSC_97:889781..885549 (- strand)
ATGGGGACCCGTGAGTTTATGGACTATCCGGCGGCGAAAGAGGCAGCGGAGCTGTCGTACACGTGGCAAGAGGACAAGAA
CCCGGTTTTGCGCGGATTCCCGCTTGTTGCTGCGTCAGCGCTGTACGTGTAGCCGGAGACAGCGATGGGTGGGCAGACAG
GCAGCTTACGAGTACGAGTACGGAGTACTGACATTGCATAAGGGTTACGAATGTGGGCCTCGTCAGCAGATATGTCTGGA
GGAACACGGGATTCGACAAGTTGAAGAACATTCCAGGCCTGGGCCAGGAGGTGGCGACGTTGCGGGTGAGTGAGAGTGAG
AGTGGGTGTGTGATGCAGACGGAGGGGATGTTTTGCTGGCTTGTGTACGGGAGTACTGATGAGATACGGACAGCCACGGG
TGACGCCTCTGGACTTGGGCGAGCGATCGTCGACGGCAGCGGGCAGCATGGTGGCGCCAGATGCGGCGCTGCTGGAGCGG
CAGTACATGGGCCATGGGGGGCGATTCTATGCGGCGGCGGACTACGGTGCGCTATACCGGTCGGGGGTGGCGACGCCGAC
GGACGTGGCTGAGGCGCTGTTGCCGCTGGTCCAACGAGGACAGAAGTCGCCGTACGAAGCCGCCTTTCTGGTCAGCCACG
TGGACGAGGTGCGGGCAGCGGCGGCGGCGTCGACGGCGCGCTGGGCGGCCGGTCAGCCGCTGGGTCTGCTCGACGGCGTG
CCTTTCTCGGTCAAGTGCGATATCGGCGTGGCCGGCTACGTGAGCACAATCGGCATGGCTACGCACCCGGACGACGAGGC
GTTTGGCCGGCGATATCCCTGTCTGCGGACGCCACAGACCAAGACGGCCTGGCCGGTCCGCAAGCTGCTCGAGGCTGGGG
CCGTGCTGATCGCACAGAACAACATGCACGAGGTCGGGATGGACACGACAGGATGTAATGTGAGTTGGGGTCTTTTTTTT
CTTTTCTTTCCTTCTTTCTTTCTTTCTTTCTTTCTTTATTTCCTATTTTTCTGTCATTTCTTTTCTCTCTTCCCGTTTCT
CCCAGTTTCTCTACTCTATTCTCCCTCTCACACCCACAGCCATCCACAGGAACACCGGTCAACTGGTACAACTCGTCGTA
CTATCCAGGCGGCTCGTCCTCGGGTGCTGGTTCGGCACTGGGCGCCGGGCTGGTGCCGATTGCTCTGGGCACCGACGCCG
GCGGCAGCGTGCGGATCCCGCCGGCCTTCAACGGGGTGTACGGGCTCAAGACGACGCACGACCGGGTGACGGTGATGGAC
TCGAGCATGTGTGTGATGGGGCCAATGGCCGGCAGCGTGGCCGATCTGACGGCAGCCTATCGCGTGATGGCGCAGCCAGA
CCAGACGGACCCGGTGCAGGGCCATTTTGCGGTGTCGGCGGCTGCCTCGCCAGAGAGCCCGCGCGTGGTGGGCGTGCCGC
GAGCCTGGGTGCAGCGGGCAGACGCGGCCATGGTGGCGCACTTGGACCGTCTGGTCGGCTATCTCGCGCGCGAGCACGGC
TACACCGTCGTCGACGTGGCGCTGCCGCACCTGGCCGAGGCTCAGGCAGCCCACGGGCTGACGTGTCTGAGCGAGGCGCT
CGCGGCAGCACGTGACCGCACGATGCCCGACCCAGACGGCTGGCCGGCACTGCTCAACGCGCCCAACCGGATCCTCCTCT
CGACGGCCCAACACGCTTCCGCCATCGACCTGCTCAAGGCCGGCCAGCTCCGCACCGTCCTGATGCGCCACCTCGCCCAT
CTCTTCGACCAGCATCCCGGCCTCGTCATCGTCACACCCGCTACCCCCATGGCCGGCTGGCCCATCCATCCGGCCGATCT
TCATCACGGCGTCTCTGACGGCAATATGTCCCTGCGCGCTATGCGCTACGTCTGGCTCGCCAACACCACTGGCTGCCCAT
CCGTCTGCTGCCCCATGGGCTACGTCGACCCCGCTCCAGGCCAGGCCCCCGGCCCCGTCCCGGTCGGCATCCTCGCCACC
GGCCGCTGGGGCGCCGAGGAACAGCTGCTCGCTTGGGCTGCCCTTGCTGAAAAATACCTCTACGAAGACTATCCTGGTGG
CCGTCTGCGGCCAGACAAGTGGGTCGACGTCCTGGAGGTCGCCCGTGAAAAGGCAGAGGCCAAGGCTGAGGCCGAGACCG
ACGAGGCCGGAAAGCCGGCAGTGTGAAGATGTTTGTTACGGAAACAGTTTGCACAGTATTTTGACAGTGCGTATACTGTA
CACATGAAAATATCACATGACACCTCGATATGTCTGCGGGGTGATGACGTTGCGTCTCGTAATGCTCCGTACGCGACGTC
ATGATGCTACAAGATACCTGTTTTAGTGCAGTGGACGGCGGGAATGCGGCTTCATTCTCCATCTCGCGTGCAGATATGCA
CTAACAGGAGTCAGCATGGCCTACGACTGGGAGGCGTATCGGGGAACATGTTACAACCTATACATTGACGAGCAGCGGTC
GCTCGAGGACATCATGGCGCACATGCGCGTGCACCACGGCTTTGCGCCGAGCCGGCGGGCATTCCAGAGCCACTTCCGTC
AGTGGAAGTTCCCGTCCAAGCAGGAGGCCGCGCATGAGGATGGCGGGCTAGTGCGGCGTGTGCGCGAGCTGTGGGAGCGG
AACCTGACGCAGGGCGAGATGCTGGGCCAGCTGCACCTAGAGGGCTACGACGTGCGGCTGCGCCAGCTGATGCGTCTGCG
TGCACGGCACCACCTGTTGTTGCGAGAGCCGGGCGGCGGGAGGGCGGAGCCGGTGACAGCAGGCGAGGAGGAGGAGGTGG
AGATGGAGATGGAGATGAACTTGAATGAGATGGACAAGGCGAAGGAGATTGAGGTGGACTTGGACGACATCCAGCAGCAG
CAGCAGCAGCAGCAGCGACAGGCGGAGTCGACAGAGAGGCTAGAGATGCGCAAGCGACGACGGAGGACGCGAACGTATGC
CGGGTTGCCAGCCGATCCGCCGGGACCGCCTCGTTTTCCGTCTGAGATGCCGGTCTCGCACAGCCGCCTAGTGCTAGGGC
TGGCCGAGCGAACGGGCGAGGCCACGCGGCTGTACAACCAAACGCGCGCACAGTTCCAGGCGATCTGTGCCGAGGCCGGC
ATCGTGCGCAAGACCCAAGCCAGCCCGGCCGTCTGGGAGGCCGTCAAGGAGCGTCTGGTGCGCGAGACGCCACATCTGCG
GGCCATGATGGGCGACGAGCGGAACGACAAGCGCCGGCTCGCCCTCGACGTCCTCTGCACCGACATCTGCAAACGGGTCC
GGCTGGTCGATCAGCGCATGACCCTGGCAACGGCTCGCAACACGCTCGGCCTGAACCCGCGACAGGCCCGCGACATCCGC
TCGTCGCTGTACGACATCCTCCGCGACGATCGCTTCACCAGCAAGCAGCAGGCCGGTCCGGACCATTGGCAGGCCCTGCA
GCGACTCTGGCTCGACCGCTGCGCCCACCTGCGCGACCTGCTCGCCCCCGGCACCGACAAGAGTCCGTTGCAGGCCCGAC
GCGCCAAAGCTGTCGGCGCGCTGGCCCGCGACGTCGTGAAGCGGTGGCAGGACGACCAGCGACGACCCAAGCAGAAGAAG
CAGCCGGCCAGGGCAGACAGTGAAAGCGTCCTGGCGAGAAGCACCGCTAGCAGCGATCCGCCCCTGCAGCTCGGCGACGG
TCTCTCGTCGCTGATCGTCGATGCTCAGCCGTCGCTTTTTTCTCTGCAGCTACAGTCCCTGCCGTTTGCGCCAGGCCTGC
CGCTGCCACTTCCGCTTCCTCTGCCGCTTCCACTCCCACCACTCCTGCTGACCCTGCCGCTGCCGCTGCCTCTGCGCACC
CGCTTCGCCCCCTACTTCCGGCTGCACCCACTGTCGACATATCCGGCGCCCAGCCGGTTATGGATCGGCCTGCCCATCGG
CAGCGACCCGACCGTGGCCGAGCTGCGGGCCGTCGCCATCGCTGGCCTGCCACACGTCCTCTGCGGCTTCATTCAGGGCG
TGCTGCGCGGCGAGGGAGGAGAGAGCGGTGGAGATGGTGATGCTCTGGACGTCAAGCAGACCGACAGCAGCGTCGACGAC
GACGACGACGACGACGACGACGACGACATGGTCGAAGAGGTGCGCGTGCAGATCGCCACGGACGAACAGCTGCAGGCGTT
TTTGCGAAGCCTCGGGCCGGAGGAGTCGCCCGTGTTCGTGGTGCAGCTGCTGTCGACCTGGACGGACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62