GenePrediction:GLEAN_5256 Details

Name: GLEAN_5256
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:873689..872897 (- strand)
Length: 793
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:873689..873650 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_97:873162..872897 (- strand)
Length: 266
>GLEAN_5256 class=GenePrediction position=GCSC_97:873689..872897 (- strand)
ATGCTCTGGCAACTGCGTCATTGGAGACGGAACCGATGCGGTGAGGCCGGAACAACTCGAACAAGCGTCCCCTCCATGGC
CCCTGTCCCCTGTTGAGCACCCCCTCCTGCATCTCCACACATCCCTGCCCACGCGAACGCTCCATTTCCTCCTGGCCCCA
GGCAGCAGAAGCCATTCCAGGACATGCGCTAACTCGTGTTCACAAGACTGCGACGAAAAGCGCGCTAGCCAACTCCCGTA
CAGCTGTTCTGCCGTCCAGGTCATCTCGAAACGGCCGATCCTAGCTCCTTGTCTCTTTTTTTGCCTGCTTGCCTGCTTGC
CTGCTTGTCTGCCTTCTCTTTCTCACGCACACCCCCCCTCCAAGCAAGCCGAACACTGTCATACCCCGTAATTCGCTTTC
TAATTGTCTTTTGCGCCTTGCCCGACCTTTCTCGTCCATATAAGTTTATCCTGCTCGCCCACCCAAATCCCCATCTTCGT
TTTTTTTTCTTTTGATTCCCATATCTCGGTCATCTACTCTTCCACAGACTCTTGGTGCTTCATTGCCCTCAACGGAAACT
TCAAGCTCACTTCACTACTCACAAACCAACAACTCACCACCGTCCAACTCAAGGCTCCCCCAACCACTTACGGGATCCTG
CAGTCAAGTCACACCCAGGTCGACTATCACAACCTCATCACATCAGCCATCATGCAGCAGTCAAACGTCGCAATGCTTGA
GCAGCGCCCATCTCACTTCCCGCCCTGCCCGGGCCCGCCGCCAAGTCGTCCGCTGCCGCCTCTGCCGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62