GenePrediction:GLEAN_5259 Details

Name: GLEAN_5259
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:864262..862514 (- strand)
Length: 1749
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:864262..864033 (- strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_97:863651..862894 (- strand)
Length: 758
Type: CDS
Source: GLEAN
Position: GCSC_97:862725..862514 (- strand)
Length: 212
>GLEAN_5259 class=GenePrediction position=GCSC_97:864262..862514 (- strand)
ATGAACATCGACGACTGGGCAGACGGTGCGGACGATGCGCGCGAGGCTGTCGACGGAGAGGCTGACGCGGCCAACATGGT
CGATGTGGATGAGGCAGCGGTAGTGACGGCCTGGTCAGACATGGACACGGACGAGATCGGGTCGTGCAGCTCGGACGAAC
TGTACGAGCGACGGCCGAATCGGTGGCACGGATCGGCGAAAGCATGGCGACGGATGACGGCGCAGGATCGGTTGGTGGCC
CGGGTGATGACGCGGGTGCGCAACCGAGATCTGGCGTTGCATCTGTACAACACGCAGATGTTGAAGCAGCGACAGGAGGA
GCTCCAGAGGGTGGAAGGGGAGAGAGAGGGGGAGGACGAAGGAAGAGATGGAGAGGGAAGAATTGAAGACAAAGAGAGAG
AGAGAGGAGAAGGAGAAGAAGGGGACGAAAATGGAGGAGATGGAAAGAAGGAACAAGAAGAACAATCTGGCCAACGAAAG
AGACGAAGAATCTGGATGCCGAGACCGCCCTGGACAGCCTGGCCGCAGCGCATGGGGGCTGACGGACGGCGCCACGGATG
GGACGACGACGCCGCCGACGACGACGAGTACTACGGCCACGGCGGAGGCAGAGCCCGGATCGGGAGGCCGAGCGAGCCGC
TGGAGGAGGAGCTGACCGCGACGATCCTGCGGCTGGCCAAGGAGCGCTTCCGGCGACGGGTGTGGGCAGGGCCTGAAGCG
GAGGAAGAGGCTGGCCGCAGCGAGGACGAGGGGGACCGCGACGATGACGGTGGCGACGAGACGTCCAGAGCGAGGCAGAC
GCACAAGCGACGGCGTCCTGACGTGGCGACTGTCTCGGCGACCGTCTCGTCTGACGATGTGCTCTCGGCAGCACTGCTGC
GACCATCCGTGCGTCACGTGATATCCCAAGTAGACCGCGCGTTGTTGGTGCTACACAACGGCCGAGCCGTCGGGATGCGG
GGGCCGCTGGCAGACGCGTCAGACGACTCGTCGGGGGGAGAAGAGGAGGAAGCAGGATCCGCTGCTCGCTCTCCCCGGGA
CAGCACGACCGGCCGCGTTGGGCCTCCACCGCTTCACCCGGCATGGCGGCCGATGACGGCAACCAGCATCGACGCGTCAC
AGGCGAGACTCATGAGCCGGTGGCGACCGCGCGACTGGAGCGACGTGCTGGGGGCGGCGGCGCTGGCCGGTTTCGAGGCA
GACGTGGTGGCGCGAACGGCACAGCGGTGCGCCGACCTCTTCGGCCAGAGCATGGCGCTGGATACGCTGGGAGGGGAAGA
GGGGGAGAGAGGGGGGGTGGTCGGAAAGAAGAAACGACAGCCTGGCCGGACGGCTCATCGGCGGACGGTCTACAGGCCTC
GGCCAGAGGGTGAGCGATATACCATACCGGACTACACGGACGAGGAAGAGGAGAAGGAGAAGGAGAAGAAAGAAAGACAG
AAGGAAGGACAGAGTGAAGGCCAAAAGGAAGGACAGAAGGAAGGTCAGACTGAAGGACAAGAGGAAGAACAAGGAGACCA
ACAAAAAGACGCAGCAGAGACCATAACAGCAGACGGCCAGCCACCACCACCGCTCGTCGTCTATGTGCCCGCACGCAAGA
CCGAGTACGAGCCGATCTGCTGTCCGATTGCCGACTGTCCCCGGGCTGACGAAGGCTTTGCCCGCCGCACCAACCTCGTC
CGGCATCTGCGTATCGTGCACGGGGCCATCGCGACAGCCAAGAAGGAGGAGGCCACGATGGAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62