GenePrediction:GLEAN_525 Details

Name: GLEAN_525
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:374549..375280 (+ strand)
Length: 732
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:374549..374635 (+ strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:374692..374878 (+ strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_97:374934..375280 (+ strand)
Length: 347
>GLEAN_525 class=GenePrediction position=GCSC_97:374549..375280 (+ strand)
ATGCCTTCCCTCCTGCTGGTGGTGTTTCTCGTCGAGCTGGCCATTCAGGTGGTCAACTCGCTCGGGGCCGATACGATTTC
GAATGCTGTATGTGTCGAGTCTTGCGTCTGGCCCTCTTTCTCTGTTCTCTCTAACTCTCCCAGCTCTGGAAGGTCTACTG
CTGCATCCCATCGCGGCGCTCAGCCGTCACCGAAGAGCAGCGGAAGCTGCAGCTTGATTATCTTGAACTGCGTCGCGAGC
TGCATGCGACCAGCAGCCAGGACGAGTTTGCCAAATGGGCGCGGCTGAGACGGCAGCACGACAAGCTGTTGGAGCAGCTG
GAGGCAAAAAGTGCGTGTCCTCTGCCCCTCTCCGGTTGTCTTCGCTCCCCCCCTAACAAGGCCAGAATCGTCTCTCGACA
CCGGCCGCCGGTCCTTTGACTCGGTCGTCACGGTCTCCCGGCTCGTGCTCACGCGCGGACTGCAGTACTTTTTGCCGTTC
TGGTTCGCCCGGGCGCCCATGTTCTGGCTGCCCCACGGCTGGTTCCCCGGCTACGCCGAGTGGCTGCTGGCGTTTCCTCG
AGCGCCCCGCGGCAGCGTCAGCATCACGTCGTGGCAGCTGGCCTGTCTGGGCGTGCTGGTGCTGCTGCGCGACACGGTGC
AGGCGCTGCTGGCGCTCTCGGCAACGACGGAGACGAAGGACAAGACGCCGGCGGCCAGAGAGAGCCCGGTGGCCGCGCAG
AAGGCGGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62