GenePrediction:GLEAN_5260 Details

Name: GLEAN_5260
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:857738..855509 (- strand)
Length: 2230
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:857738..857531 (- strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_97:857477..855742 (- strand)
Length: 1736
Type: CDS
Source: GLEAN
Position: GCSC_97:855679..855509 (- strand)
Length: 171
>GLEAN_5260 class=GenePrediction position=GCSC_97:857738..855509 (- strand)
ATGGCGTTTCCTTTTCGGGACATCAACGTGCAAGTGTCGGCGGACTCGTACATTTTCAAGTCGCCGTCGTCGCCGGACGC
GTTGGCACTGACGATCGACCGGCCGACGGGCGAGGTGCGGCTGGATGACGCGGCGCTACTCTCGGGCAAGCGAGCGTCCC
GCATCTTTAGCATCAAGGGCATTCTGGGCATGATCCAGCTGCGGCTCGGTGAGTGGGGGAGAAGGAGTTTCTCCCTGCTG
GTCGTTGACTGACTGTGGCAGACAAATATGTGATTGTGATTACCAAGGACGAACCGGTGGGCCGGCTCAAGGGCCACATG
GTACACCGGATTGCGGCGGTGGACTTTCTGCCGGTACACGAGCGGCAGGTGCGGGACCCGGACGAGGACCGGTTCCTGTC
GCTGCTGCGCGGGTTTCTCCGGTCGGGGCGGATGCACTATTCGTACACGCTGGACCTGACGAACAGCTTCCAGCGGCAGG
CGGCACAGCAGGACGCAGCAGCGATGACGGCGGGCGGACAAGAACTGCCGCTGTGGATGCGAGCAGACGACCGATTTTTC
TGGAACCGGTTTGTGCAGTCGGACCTGATCGACTTCCGGCGCAAGGGTGCACGAGGCCAGCCGGGGCCGCAGGCAGGGGC
AGACCCGTATATCCTGGCGGTGGTGTTTGGCGTGCTGGAAATCAAGCCGACGACGTTCCGAGGACGGCCACTGACGCTGG
CCCTGCTGACGCGACGGTCACGATTCCGGGGCGGGACGCGGTTCTTCTCGCGCGGCATGGACGCGGAGGGCCACGTGGCC
AACTACAACGAGACAGAGCTGGTGGTGGTGCTCAACGACAGCGGTGGCAGCAGCATGGGCGGGTTCAGCAGCGGTGGCGG
CAGCAACAGCGGCGGCGGCAGCACGGCGGACGAGACGCAGATTCTGTCGTACGTGCAGACGCGCGGCAGCGTGCCGACGT
TCTGGGGTGAGATCAACAACCTCAAGTACACGCCGAAGCTGGAGGTACGCAGCGACGCGCGGGGAATCGAGGCGGCCGTG
CCGGCAGCGACGGCACACTTTGGCGAGCAGGTGCGGCTGTACGGCGACAACTACCTGGTCAACCTGGTCAACCAGAAGGG
ACGGGAGCAGCGGGTCAAGGAAGCGTACGAGCGGCTGGTGCGCGGGATGGCAGCGACGCCGGGCACGGCGCAGAGTGTGG
CGGCCCACGTGCACTATATCTACTTTGACTTCCACGCCGAGACCAAGGGCATGCGGCTGGAGCGGGCAGCCTTGCTGCTG
GACCGGATGCAGGAGGCGCTGGTGGCGCAGCAGTACTTCCGGGCGGCCGACATGCCGGCATCGGCACGGCTGGAGGTGCG
CAGCCTGCAGACGTCGATGGTGCGGACGAACTGCATGGACTGTCTGGACCGGACCAACGTGGTGCAGACGATGCTGGCGC
GCTGGACGCTGGAGCGCATGTTTGCCGACGTCGGGCTGATGCCGCGGCGGAGCGACAAGAACGCGGGCGTGGGCTCGTCG
TCGACGCTGCAGGCGCAGGATCCCGAGTTTGAGCTGCTCTTCCGGAATCTCTGGTCCGACAACGCCGACCTGGTGGCGGC
CAGCTATGCCGGCACCGGTGCCATGAAGACGGACATGACGCGGCTTGGCCGACGCACCAAGCGCGGCGCCCTGCGCGACG
GCCAGATCGCCGTGACGCGCTACTGCCTCAACAACTTTTTCGACGGTCCGCGCCAGGATGCTTTTGACCTCTTTCTCGGC
AGCTACCTGCCTGGTGAGGCCGCTGTCGGACCGTCGCTCGTCTTTGCCGACCGCCGCCCCGTGCTCATCCAGGCGGTGCC
GTACGTCTTTGCCTTTAGCGTCTTCTTCCTGCTCGTCGGCCTCTTTACCCGCCGGATGCCCGACTCGGCCGTGCTGCCGC
TGCGGCTCTTCCTGCTCTTCTGGGGCGTCGTGGCTGCCTACAGCGGCCATTTTATGCTCCGGACGGGCGAGCTCTATGTG
AGTTTGGTGGTGTCGTCTTGTCCATGGTGTCGTCTTCGTCTGTCGCTAATGGCCCCCAGGTCAACTGGCCCAAACTGATC
CCCCGGCCGTCGTCGGTCGAGGACTACCGCGAAGCCATGAACAAGGCCCGCAAGGACAAGCTTCTGGGCGCGCTTGTCAC
CCGGCACGAGCGCGGCCTCAGCACGGCGCGCTACTCGAGCGCCGAGGAGGGGAAGAAGCGGATCGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62