GenePrediction:GLEAN_5261 Details

Name: GLEAN_5261
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:848303..844465 (- strand)
Length: 3839
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:848303..847836 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_97:847782..845599 (- strand)
Length: 2184
Type: CDS
Source: GLEAN
Position: GCSC_97:845540..844897 (- strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_97:844795..844465 (- strand)
Length: 331
>GLEAN_5261 class=GenePrediction position=GCSC_97:848303..844465 (- strand)
ATGACGCACCCGCGGGAACACCCCTCGCGAAGGGCCACCAATGCCTCGTCCGCCACCATAATGCCGGGCACGAGAGCCGG
CGCGCCAGCCGTGCGGCCAGGACTGCGACAGACCACCAAACGCGGACCGACAGCCCGTCACGTATCGGGCATCCCGTCGT
CGTTATCATCGTCGGCACCGACGCCGGGCGGGCGTATCAGCCGGATGCGGGCCACGTCGCCGGCCGAGTCCGTGGCGTCG
ATCGCGACGACGGGAACGAAGCGCAAGGAGCGCGAGTTTGAGCTGGAAGGCCCGTCGGTTGGCGAAGAGACCAACATCAA
CGTGGTGGTGCGGTGTCGCGGACGTACCGAGCGGGAAGTGCGCGAGAACAGCGCGGTGGTGGCGACGACGGATGGTGCAA
TGGGCAAGACCGTGGAGCTGTCTATGGGACCGAACGCGCTCAGCAACAAGACGTACAACTTTGACCGGGTGTTTCTTCGC
CGGCGGCCGACCAGAGCATGATCTTTGACGACGTGGTCAAGCCGATCCTGGACCAGATGATGACCGGCTTCAACTGCACC
ATCTTTGCGTACGGCCAGACGGGCACGGGCAAGACGTACACCATGTCCGGCGATATGACGGAGACGCTAGGCCTGTTGAC
AGACGCGGCCGGTATCATCCCGCGCGTGCTGCAGGCGCTCTTCCAGAAGCTGGAGGCCGACGCGTCGGACAGCATCGTGC
GCTGCTCGTTCATCGAGCTGTACAACGAAGAGCTGCGCGACCTTCTCTCGGCCGAGGCCGACAGCGGCGGCGGCATGAAG
CTCAAGATCTACGACGACAACACGCGCAAGGGCCACGGCACGACGGTCGTGCAGGGCATGGAGGAGCGGCATCTGGCGTC
GGCGGCCGACGGCATCCAGCGGCTGCAAGAGGGCAGCATCCGGCGGCAGGTGGCGGCGACCAAGTGCAACGACCTCAGCA
GCCGCAGTCACACCGTCTTCACCATCACGGTGCAGACAAAGCACGTGGCCGAGAGCGGCGAGGACTTTTACGTGACGGGC
AAGCTCAACCTGGTGGACCTGGCCGGCAGCGAGAACATCCAGCGATCGGGGGCCGAGAACAAACGGGCGGCCGAGGCAGG
GCTGATCAACAAGAGCCTGCTGACGCTGGGCCGCGTGATCAACGCGTTGGTCGACCGAACAGCCCACGTGCCGTACCGCG
AGTCCAAGCTGACGCGGCTGCTGCAAGACTCACTCGGTGGCCGGACGAAGACGTGCATCATCGCGACGGTGTCGACGGCC
AAGAGCAACCTGGAGGAGACGATCTCGACGCTGGACTACGCCTTCCGGGCGAAGAATATACGGAACAAGCCGCAGGTGAA
CCAGCTGGTCAGCAAGAAGACGCTGCTGCGCGAGTTCACGGCCGAGATCGAGAAGCTGAAGAGCGAGCTGATCGTGACGC
GCCAGCGCAACGGCGTGTACCTGGCCCTAGACGCGTACGAGGAGATGACGGTGCAGAGCGAATCGCGGCGCATCCTGGCG
GAGGAGCAGGCCGCACGCATCGAGACGATGGAGAACAGCCTGCGCCACAAGCTGCAGGAGCTGCTGGACCTGACTAGCAG
CTTCATGGGCCTCAAGAAGGACCACGAGGGGGCGCGCGTGAGCCTGGACGCGACCAAGGCCGTGCTAGACGAGACTGAGA
CCGTGTTGGCGGCCACACGAGACGCCCTGGCCGATGAGACGCGCGTGCGCCAAGCCCACGAGGCGACCGAACGGCAGCTG
GCCGTGCTGGGCGACGAGCTGATCCGCACGCTCGGCCGCACCGTCGACGACATTGACGGCCTGCGGGCCAAGGGCCGGCG
TCGGTCGGACCTGCACGGTGCCAACCGCAACACATGGACCGAAACCCAGGCCCGGGTGGCCGACGTCACGCGGCTGGTCG
AGGGCCGCATCGCGGACTTGCGGGCATCGCAGGATGCTCACGTGACCGCTATGGCTGAACACGTCCAGGCCTTTGTGCAC
GACGGACGTCAGGACGTGGCGGGCACGCAGGCCGCCCTGGACGCGAGCCTGGCCGTTTGGGCAGCGTCCCATGACGAGTT
GCTGACTCAGCAGCGAGCAGCCAAAGGGGACGTGGATGCGATTTTGGCGGAGCTGCGAGTCGTACGGGCGCACATGCAGC
AGCGGGTGGGTGAGAGCCTGGAGTCGATTGCGGCGGCGGCTGAGCGGATCGCCGAGGACGTGCTGAGCGAGCTGGGAGCC
TTTCACGACCGGCTACATGCCTCGTACGACACGCTCGGCCAGGACTGCCAGAGCCTGTTGGACGACGTGCTGCGGCAGCT
CCGCGACCAGCGGAGCGAGTCAGACGCGCTACGACGGACAGTCGAGGCAGCGAGCCGGGCAGCGGCACAGTCGAGTGCCG
TGGTGGCGGCCCAGATCGCGGAGGCGGTCGAGGAGGAGCGACGAGTGGCCGCAGCAGACAGGCAGCAGCTGCTGGCACAG
ATCGGCAGCCTGGTCAGCGCACAGGCGAGCGTGCAGGAGGCGCGGTTCGCGGCCCGGGCAGAGGCAATCCGCGAGCAGGT
GGCACAGTCGGGTCAGTCACTCGAGGAGGGTGTGGCGACATACAGCAAGGGGATGGACGTGTGGAATGCAGCGGCAGACG
AACTTGTACAGGACATGAGCACGTCTGGGGAGAGGGTGAAGAACAAGTTGAAGGACGACTGGACGGTAAGTTGGGGGGAG
AGAAGAGAGAAGCGAGAAGCGAGAAGAAAAAGCTGACCAGCAGACTGCAAACAATCACAGCATATCCATCAAAGAGACGA
CAGAGTCGGTGCACGCCGAGACGATTCGCGTGGTGGAAGAACAGAAGACAGATCTGGACGTGCAGATGCAAGGCCTCGAC
AACCTGGTGGCCAAGGCGGCAGCCTACAGCAAGGAGCACCAGGCACGACAGGGCGTGACGGCAGCCAAGGCGTCGGCAGC
GGTGACGTCGTGTCTGTCGGAGACGGCGAGCCGGGCCCAGGAGACACACGAGCGCACAGAGGCGTTGGGGACGGCCCTGG
GCCGAGACCTGGACGGGCTGCGCGACAGCCTGGCGCCGATCGAGAGCACGCTGGCACAGCCGCTCGTCGGGCTGCGGTCG
CTCGTCAGCAGCACGTCACTACGCGAATACGTGCCGACAGGCGAGACGCCCGAAAAGGTCAAGTACGAGATCCCGACGGA
GCTGCCGCGGACGGCAGCGCGTCACGTGATTATTGGGGTCGAGGCCACCGAAGAAGACAAGGACGACGAGGACGACGACG
GCGGCGAGGACGAGAGCAACGTCGGCCTGTCGCCGTCGACAACCATCTTTGCCGACCTGGACCAGTCTCTGCAGGCCAAG
TCGCCGTCGCCAGGCAGCACGAGCCTGCGCGAGATGAACGCCAACGTGTTCTCGCCCGAAGCGAGCATTAGGCCGACGGT
ATTTGAGGGCAGCACAAGTGTGACGACGACGGCGACGGCGACGACGACCGCCACCACTACCACGGCAGCGGCCGCTACGT
CCAGGAGGAGCAGCACGCAGTCGATACCGCTGTCGAAGAGGAGCATGCGGCAGCCGCCACACAAGCAGGCCAAGACGAAG
AGCTCGCTAGCGTCGCTGCTGCAGGGACGCGAGAACGTGCCGCCAGCGGTGTTTGCACAAGGCTCATCAAGGAGAAGGAG
TCCGCGGTTAAACTAGGTGGGAGAGAGGAGAGGGAGGCCGCGTGGGGAAGGAGGTCAGCTGGTGCCAAACTGGTGGCACA
AACAGCTATAGCATATTTCGGAGTATTCGGATACCCTTTGATGCAAAAGGGAAGTTACAAGGCGTTGGACAGCCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62