GenePrediction:GLEAN_5263 Details

Name: GLEAN_5263
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:839290..838149 (- strand)
Length: 1142
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:839290..839101 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_97:839035..838149 (- strand)
Length: 887
>GLEAN_5263 class=GenePrediction position=GCSC_97:839290..838149 (- strand)
ATGGCACCCATCCAAGTCGCCGTCCTCGACGACTACATGGCCACGGCCGAGCCCTACTTCAAGAAGCTGGACCCCGACAT
CTTTGACGTCACCATCTTCCAGGACACTATCCTGCCGTACGGTCACCCGAAGACGACCCAGGATGAGAAGGACAGGCTGG
TCCGGCGGCTGGAGCCGTTCCAGATCATCTGTATGCCAGGATGCCGACTCTCCCTTTCTTTCGTTTTCCCTGCTCTCTGC
TCACCTTGTCCACAGCAACGATGCGAGAGCGGACTCCTTTTCCGGCCGCGCTCATCGAGAGGCTGCCCAACCTGCAGCTG
CTCCTGACGACGGGCACGCGCAACCTGTCTCTGGACCTGGAAGCCTTCCGGAAGCAGGCGATCCCCGTGGGCGGCACCAT
AGCGGCGGCGCGGCCTGCTGGCGGCCCCGACAGCACGGTGCAGCACTTTATCGCCGTGCTGCTGGCAGCGGCGCGCAACG
TGGCCGCTGACGACCTGTCCGTCAAGACGGGCGGCTGGCAGACAGGGCCGGCCGTCTTTGGTCTGTCCGGCAAGGTGTAT
GCCACCGTTGGTCTCGGCCGTCTGGGCGCCGGCACGGCCAAGATCTTGCATCAGTCCTTTGGCATGCGCGTCCTCGCCTG
GAGCCCCAACCTGACGCAGGCCAAGGCCGATGAGGCTGCCGTTCAGGCCGGCCTGCCGGCCGAGGCTGCCGACGGCTCCA
AGACGTTCCTGGCCGTCAGCCGTGAGTGCCTCTTCCGCACAGCCGACGTGCTGGCCGTGCACGTCGTGCTGTCGGACCGC
TCGCGCGGCCTCATTGCGGCCAAGGACTTGGCGCTGCTGAAACAGGACAGCATCTTTGTCAACACGTCGCGCGGGCCCAT
CGTCGTCGAGGAGGACCTGCTGGACACGCTGCGCCGCGGCAGCATCAACCGCGCCGCCCTGGACGTCTTTGACATTGAAC
CGCTACCGGCCGACAGCCCTTGGCGCACCACGGCCTGGGGCAAGGACGGCCGGAGCCGGGTTACGCTGACGCCTCACACC
GGTTACGGCGAGCGGGTCGCGCTGGAGAAATGGTACGAGCTGCAGGTCGAGAACATTGTCCGCTGGCACAAGGGCGAGCA
GCTCGAGTCCAGGCTGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62