GenePrediction:GLEAN_5264 Details

Name: GLEAN_5264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:829908..828345 (- strand)
Length: 1564
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:829908..829810 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_97:829226..828834 (- strand)
Length: 393
Type: CDS
Source: GLEAN
Position: GCSC_97:828776..828345 (- strand)
Length: 432
>GLEAN_5264 class=GenePrediction position=GCSC_97:829908..828345 (- strand)
ATGGCCCGTCCATCCAAGAAACAGCTCGCTGAGGCTGCTAAAGTCGACGTGCCGGCCAAGGTCATTGACGTCGACAACTT
TATCAGAGTTCGCGATTCGGTGAGTCTGCAGCCCGTTTGCCCTGTCCTGCTCTTCTCTCTGCTTTGTTCACTTGCATTTC
TTCCCCTCCCATCGTATTTCCTCCCAACGTCCAGGGCCACAGGGCATCTGCGACCGGCGAGCCCAAGCCCAAGAAAGCCG
GCCTCATCGTTACCATTCCTTATCTGTCACGTCTCATGCTCTTGCTTTTACCCCATCGCACCAATCTCCCCATGCACTCC
TCAATCTCCACACCGGCATGACAGCGTTTATGCTACAGCCTACGCTGGCGGCTCCTTCAAGTGTGCCGCATCCTATGCAG
CGACCAAAAAGCCTCACATTTCCCCATTTTCATTTCATGATCAGCAAACAATCTCACATCATCACTGCACCACATTTCAA
TCTACATCAAACCGCCCGGTTTGTGACACCCGATGCAATGAAACGATATCATGTTGCAAATCCCGGTGCTTGCCGGCACT
TGTTGTGATTGCATTTGCATCTCAGACGCAGTCCAGTGACGCGCCTGCATCCTCTCCGATCGAAAAGTTTGAGTAGAGAA
GACCGACAACGACAAAGCAGTACGGTTGTTAACTTGCTTCAGGTATATGCACGTCTGTCTACCATCCAGGACCTGTTGAA
GACGTTCTCGACGGACTACCTGCGCCAGACCAACCTCCTCCTTGGTGAGGGCACCAACCTGGAGCAGCCGGCCGAGTTTG
CAGGGTTTGAGAATGCCATCAACCTGCTGCCGAACCCCGGCCCGCTATTGCAGCCGATGGCTGCTGTAGCGCAGCCGGCG
GTTGAGGAGAAGAAGGAGCGGAAGAAGCGCACACACGACCCCAACGCACCTAAGCGACCGTTGACGCCGTACTTCCTGTA
CATGCAGACGGCACGCCCTATCATTGCCAACGATCTGGGGGTGGAGGCGCCGAAAGGTGCCGTCCAGGAGGAGGGCCAGC
GTCGGTGGAGCACGATGAACGCGCACGACAAGGGTGTAAGTGCTTTGTCTCTTTATCTTCGCCTCTCTGTCTGTCTCATA
CTAATTGGCCAGGGCTGGGACCGGGCATACCAATACAACCTGCGGCTGTACAATGCACGGGTGCACTCGTATAAGTCTGG
CAATGGCAACGCCCGTCTGATGACGGACGAGGAGGCGCTGAGGTATGCCGATGAGTTTCACATCCCGATGCCGACTAGCA
AGGAGGTGGACACCAGCAACGACCAAGAGGCGATTGCGGAGCAGCTCCAGGCTGGCCCAGTCGAGGAGGAGGAAGAGGAA
GAGGAAGAGGAGCAGCCGGCAGCCAAGACGCCCAAGTCAGCGAAGAAGGTGACTGGAAAGCGGAAGACGGCGACTCCTGG
TGCAGAAGCAGAGGTGGCGACTCCGGCCAGCCCCGACAAGAAGCGCAAGCGACCCTCCAAGGTAACTGAGGAGAAAGAGC
CAGAGCCCAAGAAGTCCGGACGCAAGAAGGCTAAGAGCGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62