GenePrediction:GLEAN_5268 Details

Name: GLEAN_5268
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:809040..807818 (- strand)
Length: 1223
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:809040..808681 (- strand)
Length: 360
Type: CDS
Source: GLEAN
Position: GCSC_97:808637..808041 (- strand)
Length: 597
Type: CDS
Source: GLEAN
Position: GCSC_97:807973..807818 (- strand)
Length: 156
>GLEAN_5268 class=GenePrediction position=GCSC_97:809040..807818 (- strand)
ATGCAATTCCGGCTTTTCTTGCCATCGACATTGCACAAATACGGTCTCTCGCCCGACAGCAATCATGGCCAAGACCGGTC
TCACACGAATAACGGCAGCCTCGGCTGCTGCCACAGCCATGGCGACGTTCATGCCTCGTCGGCCAACATTTTGTCGACAG
GTGCCTCGAGTGACCTCTGCGACTCTGTCGACGGCCTCGCCGAACAGGACGATGCGGCCGCCGTGTCTGCGTCGTTACCA
CGCATCCGCCCCCGCATCGCACTCCTACTCCTCCTACTCCTCCCCGTCCGCGTCGCCGAGACGGCCGCATATGCTCAGCT
CGGCCTCAGCCTTGGCCTCAGCCTCTTCCTCTCAGCCTTGGTGGGCTCTCGGGGGCCGCGGCCGTCGCACCATCTTCATC
CAGACCGAGAGCACGCCGAACGCGGACGCAATCAAGTTTCTGCCGAATCACCAGGTGCTACCGGAGGGGATTGCCTCGCC
GTTCATCGAATACCTCAGCCCGCGGGCCACGATCGCGCCGCCGTACCCGTCGCCGCTGGCGGCACAGCTGATGAACGTCG
ATGGCGTCACGGCCGTGTTCTACGGCAGCGACTTTATCACGGTGACCAAGGCGACCGACGCCAATTGGGCGCATATTCGG
CCTGAGGTGTTTGCGCTCATCACCGAGGCCATCACGTCGGGCCAGGCGATCGTGCGGCCGTCAGCGACAGGCAGCGCCGG
GGCCGAGGGCGTCGACGGGACGCACGGCGAGGGTGCCGAGGCAGAAGCAGTGCACGAGGACTCGCTACAATACAACGAGA
ACGACAGCGAGGTCGTCGGCATGATCAAGGAGCTGCTGGAGACGCGGATCCGACCGGCCATCCAGGAGGACGGCGGCGAC
ATTGAGTTTCGCGGCTTCGAGGACGGCGAGGTGCTGCTTAAGCTACGGGGCGCATGCCGGACGTGCGACTCCAGCACGGT
GACGCTGAAAAACGGCATTGAGAGCATGCTGATGCACTATGTACGTCCTTTTTTTTTTTTTTAAAAAAACCCAACCATTT
TTCTACTCACCGCGCTAACACATACAGATCGAAGAAGTCAAGGTCGTGAGGCAGGTGCTGGACCAGGAGGAAGAGGTGTC
GCTGGCCGAGTTTGCCAAGTTCGAGGAGAAGCTGCGGCTGCAAAAGGGCTCGGTGCCGCCGTCGACGACAGGAAAGGACA
CTCTAGACACGGTCCCGGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62