GenePrediction:GLEAN_5269 Details

Name: GLEAN_5269
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:803515..800613 (- strand)
Length: 2903
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:803515..801354 (- strand)
Length: 2162
Type: CDS
Source: GLEAN
Position: GCSC_97:801285..800613 (- strand)
Length: 673
>GLEAN_5269 class=GenePrediction position=GCSC_97:803515..800613 (- strand)
ATGAGTGCCAGCATTAAACCCGGTCCACCAACCAAACTTGGCCAAGGTGGCCTCCCCACCGCGCCCAGCAATCAAGCCAT
CCTGCTGGACAAGTTGAACCGACGGTCGACGCCTGACTCTGAAGCTCTGGCCAGCTCAGATGACGAGGGTGAAACACATC
GCACAGAACCCCTCTTTCCAGTCCCCTCCAACCAGCCGCCCAGACCGGCAGTCAGACGTGCCTCGTGGCTGAACGACACC
AGTCAAGCCAGCGTGCGCCCACGGAACGAATCGTTTGCAAGCGCCTCCATGTCGCCCACCACGCCGCACCCCATCACGCC
GTCTACGGACGCCGGCGCTGTTGCTGCCGCCTGGAACGCACACCCCACCGCGCCCGCGAACGTGCTCAACCGCGCACACA
CCTCATCGGCTTCCTTTGCGTGGGGCACCGGCATCTGGAATACTGATATGAAGGATCCGCTGTCTAGGTTGTCCGAGGTG
CTTCCCTCTCCCACGTCCGTCATGCCGCCCGGATCTGGTGGCAGCTCTTCTTTCTTCAGTTCGGACACCATGCCCACGCA
GACCTCTCCGGTGCCGAGAGGGCACGGTGTCGGGACCACGTCGCAAATCCCTTTTGCCATCCCCCTGCACCCGACTCCGA
AGACATACCGATCACAGTCGTACTCGGTCGGCCAGCTCGATGCCGAGACCGCCATGGCGGCCGCAGCCGCCCAGCCTTTG
GCCATCCCACCCGCCTCCTTGGCTAACTCTCGGGTACGACCGATGACACATGCGGGCCTTCACCACCGACCGTCGCGGCC
TAGCATGCTCAGTGAGATGTCGAGCGAGGGAGGAATGCTCGGCAAGGTCAAGGAGGTCGATGACGATGACGACGAAAGCA
CAAACGACTCTTCACAAGGCAGCCAGCAGCTGTCGGCCGAGGCTAAGACGATCGAGATGCTGGCTCGCGAGAATGCCATC
CTGCGCCAGCAAGCGAACCAGCAGTACCACAACGCTCGCATCCGGCCCCGCGCGTCTACTGCTGCTGCCTATGGCATCGG
GAATGGATACGGTTTCCAGGAGCCGGTACCAGAAGAATCCGACTATGCTGTCGACGAGCTGGACGAAGCCTTGGACGGTG
AGATTGCTGCCGCTACCAAGAGGGCGGCCATGCGGAGGATGAGCGAGTACGGCGCCACTGGGCCATTCCGGTCGCCTTTT
GCCCTCGAAAACCGGAAGCTGGAGAACGTGAAAAAGGCGTTTTGGCAAAGCTCTCCTGGCTTCCCTGACAACTCCCCCAG
CCGCCGGCACTCTTTTGCCGATATTCCGACGAGACAGGCATCCATCAGCTCCATCAGCGAGGTCGTCCTCGCCCACGAGG
CGAGCGCGCAGGAGGCGCAGAACGTCGGCCCCGACTTCGGCTCGTCCTTTACTGACGCCCATCTGTTCCCTTCAAATCAG
TCAGCCGCCCAGTCACTATATACGGGCGGACCAGGCGCCACGTTGATGGGTGCTCAGCAAGCCGCTCTCCAGCATCAGCA
GCCTTCGCCACTGAGTGCCGCATATGGCGCGAGCTCCTATCCGTCTCCGTACGGCCTGCATGCGCCAGCATTCTCTGTCC
GTCCGACGTCACCGCAGCGAGGCATGTACGCAATGACACAGCCAAATCGCTCGACACCGCTTCACATCGTCCTGTTCAAG
TGTGCCCGGGCCGATGTGTTCTACATCCAGGAAGGCACGGGACTCACAGTCAAGCCTGGTGATCTTGTGATCGTGGAGGC
GGATCGTGGCACAGACCTGGGAACAGTCGCAGTGGATAGTGTCGATTGGGTTGAAGCCCGGCGTATGAAGGAGCACTATG
CCGAGGAGCAGTACAAGTGGCTCATGATGTACTCGCAGAATGCAGCTGCTGCGCAGGACGGTGTTGGTGCTGGTCTCATG
GCCTCGGCAACGGGACTTCAGGGGAGTGCTGTTGGAGGTATGGGCCCTCCGGGCCAACACCACATGCAAGAGCCGAATGC
CGGCGAGCTCAAGCCGAAGCTGATCAAACGCCTTGCTCAAAACCACGAGATCCACGCCTTGCGCGATAAGGAGGGTAACG
AGGCCAAGGCGAAGCGTGTCTGCATGCAGAAAGTGAAGGAGCATGGCCTCAACATGGAGATCCTCGACGCGGAATTTCAG
ATGTGAGTCGTTCGACATATCCCCAACTGGACACAGTACAACGCAGCTTGCTAACCCTTACGCTTGATAGGGACTGGAAG
AAGCTCACCTTTTACTACTTTGCCGATGCGTACATCAACTTCAACTCGCTTGTCACCGACCTGTTCAAGATCTACAAGAC
GCGAATTTGGATGTCTGCTATCAACCCGGCCTCCTTTGCGAGCCAGCCGCTCGGTCTGCAGGCCCCCAGTGGCATTGGAC
CGGGGGCTGTCGGCGTGAGACGGAGCTCGACGTCTAACCGCCAACAGGTACAACATGGGGAACACCAACAGCAGCTCCAA
GCACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAATCGGTGTCTCCATATCCCACCTCCAACCTTGGTGGACGCGGATA
TCCTGGAACTATCAGCCCGCAGCCTCCTCTGACAGCGTCTGCAGCCAATGCCACCGTCGGTGTGATCGGAAGCTATCCAT
CCCCATTGCAGTATAACCCCTATGCTACCTTTGGGAGCATTCCACGTGTGCCCGTTATTGGCTACGGCCAGGGCGGCATA
CCGACCGGTGCAGACGGCTACTCGATCGCCTACGCTTCTGCAGCCGACTACCAGACGATGCGCGGTGGTCGTTTCCCTGC
CAATCAAACCGAAGCTGCCCAGCATGGACAGGGTCTATCGCCAATTGGTGTTTCCGGAGACTGGGCCGGATCCTTTCAAG
GCCTCTCTCTCAACAGCCGTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62