GenePrediction:GLEAN_526 Details

Name: GLEAN_526
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:376089..377451 (+ strand)
Length: 1363
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:376089..376108 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_97:376167..377451 (+ strand)
Length: 1285
>GLEAN_526 class=GenePrediction position=GCSC_97:376089..377451 (+ strand)
ATGGTGATTCCGTGGGGAACGTGAGTGTTGTTCTGGACCTTTTCATCGCATGTCCCGGGCTCTGCTGACATGTGCCAGAA
TCCAGTCGCTGCTGCTCTTTTTTGGGCCGCTGCTGCTGCCGCGCGCCATTGCGCTGTACCGGAGCGTCCAGGCAGCCGCA
GCGCGTCAGCAGCAGCAGCAGCAGCAGCAGGCGGGTGGTCCTCGGGATGTGGAGGGGACTCATCGGCTGCGGTGGCGCGC
GGCGGCGGTGCTGGCGGTGCTGGCGGCGGCGGCCGTGAAGGGATTCTGGCGGGCGGGCGTGCTGGGCGGCAGCGTGGTGT
CGCCGCTGGCCGAGAACATCTTTGTGGCGACTGCGTCGCGGCTGCAGACGCCGACGGACGTGCTGTTCACGCGGCTGGCA
GCACGGCGGCCGGGCCGGCTACTGACGGCGGCCGACGAGGCGCTGCGAGCACGTCTAGTCAGCCTAGACTCGCGGCTACT
ATACCTACAGTTCGGGCCGGACGTCCTGGTCGGCTGTCCGTTCTGTGCAGATGGCGGCGACGGCAGCAATGGCAGCAGCA
GCAGCAGCAGCAGCACGACGGCGTACCTGTGCTATGCGCTCGTCGACCTGGCCGCCCAGCACCTGACGACGCTGGTGCTG
ATCGCCCTGGCGACCTCGCCCTTGGTGGTGTTGGGGCGCAGAGGTGGTGGCGGGAGGGCTAGCGGATCGGGAGCACCAGG
ATCCGACAGGACTGACCTCGCATACGATCTTGCTGCGGCTCGCACTCGCCGCTGGCGCACGCCTGCTACCGTGGCTACGC
TGCTGCTGGCTGCTGCCGACATGGCACTGCTGGCCACGTACAACCACCAGGCCAATGCCCGGGCCACCCGGCTGGCTGAC
CTCGACTGCTTCTTCTGGACGATGCAGCGCGTCCGCGGTCTTGTCAGCGGCCTGCTGCTCGGCGGCCTGGGCTTGCTGCT
CTACTGCGCTGTCAGCGGGTGGGCACCCAATCGCCCGGCTGGCCCCCTCCTCCGACTCTTCCTCTTCGGACCGCTGCCGG
CTGAGAGCCCGGCTGAACGGATCACCACGACCGCGCGCGCCCTGGCCACGACCCGCAGCCGGCTCAACGCTGCTGCCATC
GTCAAGAATACGGCGCTGCGCGACGTCGAGCTTCGGGCTCGCACCCAGGCGTATTGGGCGCGCGAGGTCGCCCTCGTGGC
CGAGGCCATGGAGGAACGCGACGTCATCGAGGGCATCAACGACGCGCTCGAGAACCGTCTGGACATGCGACAGATTGAAC
ACGACGCCGACGTGTACGTGCAGAATGTCGTGCCGCTGCGAGGTGGAAGTGAGAGAAGTGAAGGTGGTGATGCCGGTGCA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62