GenePrediction:GLEAN_5270 Details

Name: GLEAN_5270
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:799506..796941 (- strand)
Length: 2566
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:799506..799473 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_97:799393..799291 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_97:799228..799094 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_97:799018..798487 (- strand)
Length: 532
Type: CDS
Source: GLEAN
Position: GCSC_97:798130..797684 (- strand)
Length: 447
Type: CDS
Source: GLEAN
Position: GCSC_97:797624..796941 (- strand)
Length: 684
>GLEAN_5270 class=GenePrediction position=GCSC_97:799506..796941 (- strand)
ATGGCTCCCCGGAAGAACAAGGCGCGCGCCCGATGTGAGTGATTGGTGTTCGTACTTATCTAGAGAAACTATGTTAATTG
TCTTCTCTCTCTTTCACATTATCCCTACGGCAGCCTCCAGTACTTCGCTTGGCGAATCTGGCCCAGAGGAGGAGATTAGG
ACAGCTGCAACCAGGCCACGGGCGACCGGCAAGAAAGCAGCACAAAGCAGTGATGGGTGTGTATACATGGCATGGCAGTT
CTTGATCCCGCCTAATTTCAACCAGCTGATGAAATCAGCTGGGATGTCTGGCAGGATACCGTTCGGGAACAGGAGGCCGA
CCGGGTCAAGCAGTATATGAGCACGTTCCAGGAAAAGGTGGCATCGATGCGGAAGAAGGCAGTGCAGGATATGAGGCAGT
CAGAAGAGAGCCGGTAAGTAAGAATTTGCGTCTGGGCGTCGCATTTCTGACGACGCAGGATGAAAGCGGACACGACATTT
GTCGACAGAGTGAGGACTGCGTATGGAAACGGGCTTACGGAAACGGCCAGATCAGAAATGATGATGCCTAGCCGCCTCCC
TCTGCGCGAGGCTAGTGAAGAGGTCCTTGGTCTGTTTCAGTCCATGCTGTCCCGCTTTGAACGGACAAACAATGAGCTTC
GAGAACAGTGCAGCTGCTTGACAGGATTCAGCGCTAGCACCGGTAGCACCGGCCCAAGCCTTTCAGTCAAAGCAGCCTGG
CAGAAGGATCACGAAGAGGCGCGCAAGCTACTGCAATATGGCCGGGCGTACGGTGATAATCTGGTGCACGAAATAATCGT
TCCGCAGACTGACGGAAACGGTTCCGCGCCAATCGCACATGCGGACAGCATCGATCTGAACTGCACAGGGAGGTCGGCCA
TCGGGCTGTTCCCTCGCAGCCGGGCAACCCTGGTGGGTGGCCAAACATGGGGCGAGACGGCACGGACGCAAATGCAGGCA
TTGACGGGAATTGTTCGGACGCTTCCATACGAGGAGAAGGTTGAGATAGGAGGGTCCAAGGTAGTGTCGTTTGTGGATTG
TTAAAAAATTATTGCTGTGTTCAGATACACAGGTCTATCTTAGGCGGCTCTTGGGGCACTTGAAGCTTGAGCCGATTTTT
ATTGTCCATGTTGCATGAAACCTCAGCCTTGTTCACAGCTCCACTTTAGATTATCCCAGAGCCAATCAGGTACTGCTAGC
AGTAAAAAAAAGTTTATTCCGTTTATCGAGGCTTTCGCTTGCACTGCTTCCTCTTGTCGACCTTAGCTCCCCGCTGTACA
GTTTGGACGCATACAGAGCCCGGAGTCATGGCGTCAACACAGCACGTACTGTTGTCGCCGGCTGAGCTGGCCTTTTTACA
CACGTCTTTGTCGCAGACACCTCCTATCCGACCGGATGGCCGTTCGCCGACGCAATTCCGCCCTCTGCGCGCCGAGACGG
GCATGCTGCCGGGCGCAAATGGAAGTGCGCGCGTGTGTTTTTCCGATGGAACGGAGGCGATAGTGGGTGTCAAGGCTGAT
GTGGAGAAGACGCGGCGGACAGGACGGGAAGACGATGACGACGGGGACGAGGATGTCGAGGGCGGCGAAAAAGGCGGCGA
GGACAAGAAGGACGGGAACGGGGTATCGGCTTCGACATCGGCGTCATCGACATCGGGCGCGTCGTCCTGGGTTGAGGTGA
CAGTTGAAATCCCGGGACTGCGAGACGACGACAGCAACACCGTCTTTCTGGCGGCACTCTTGGCCGAGGCTCTGCTGGCC
GACGGCAACCTGGCACAGGCGCTTCGTATCAACCGGCGCTTCCACTGGAAGCTGTACCTGGATGTGAGGGACCCGTGCAA
CTGCTTCTCCGTCTCCTTGTTCTTCTCCTGCTGACTGACCAGATCCTGCTGATCTCCCCCCCGCTCTCGTATCCGCTGCC
GCTCCTGTCGCTGACCAGCCATCTGGCTCTGCTGGCGACGCGGCTTCCACGGTTGGTCTCCGAAGGCGATGAGGACCCGT
TCTTCAACGACGACTGGGACGCGTCGACGTACCTGTACCCCCGCGCGACCGAAGCCGGAGCTGAAGCCGGAGCAGCAGCA
CAGCAGCCGTTCTCGCGGCCGCCCATCACGCTTCTCGTCATGACCGTCGGCGACAGCATCCTGTTCGATCCGACGTCCGA
GGAGCTGGCCGTCGCGAACGCGGTCCTGGCCGTGTCCGTGGGCGCGTCTGAGCCTCCACGACCAGCAGAAACGACGACAG
CGCCGTCTTCCTCTTCCTCGCTCCGGCTCCTCGCCATCCGCACCATCGACCCGCCGTCACGCCTGACCGCGCCCGGCACT
CCCTACAACCCAGACACCAAGGTCAAGCAGCAGCAGCAGCAGCAGCAGGCTGCCGGCTCGTCCGCGCCACAGGAAAACAG
CACGCCCTCGCGGCTGCCCGAGACTGAGGCCGTCTACGGGGTCTGGCGGGCGCCGCGAGGCGGAGCCCGCGTCGGCCTGC
TGGCGGCCATGACGCAGCGGGTGCTGGAAAAGGGCGGCGTGGCCGAGGAGGTCTTTGCCGGGCTGGGCGCGGTAGAGGTG
GTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62