GenePrediction:GLEAN_5271 Details

Name: GLEAN_5271
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:792756..791919 (- strand)
Length: 838
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:792756..792741 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_97:792379..792189 (- strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_97:792110..792016 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_97:791943..791919 (- strand)
Length: 25
>GLEAN_5271 class=GenePrediction position=GCSC_97:792756..791919 (- strand)
ATGCCTGCCGGACCCGGTAAGTTGCTTTGCTTGTTCACTAGCGAGGCTGCTGCTGCTGTTTGCTGCCGAACGAGAGCGAA
AAAATTATCGCCATACCACATGCGCCTGCGTCCACCCCCAAAAGGCCATTCGTGCCATTGACTGCCGCCTTTGTACCCCA
GACCTGCTCCCGCCTCATAGAAGGCATTGGCGTCGTATATTGAAGCTACGCAGGCTCTCTTTCGCGCGCAGTCGTGTCTG
GAGGTCGGGGAGCTGCCGAGTGGCTGTTTATAGCTCGACACAGCTGCTTCGTGCGGCATTTTCACCCGACTCTCGCAGCA
GCAGCTCATGCGCCGTTGATGCCACTCGTCGATCTCGCAGCTGACCCATTGCCATAGGTGACGCCAAGAAGGGTGCGAAC
CTCTTCAAGACCCGGTGCGCCCAGTGCCACACCGTCGACAAGGACGGTGGCAACAAGGTTGGCCCGGCGTTGCACGGCCT
CTTCGGCCGCAAGACCGGCTCCGTCGCCGGTTACGCCTACACCGATGCCAACAAGCAGAAGGGCATCACCTGGACCGACG
AGACTCTGGTAGGCTTCCACGCCCACAGCCACCAGCCTTGGGCTGTGCTCTGGCTGCACTTCAATACTGACAAGCTCCTC
TTCTAGTTCACCTACCTCGAGAACCCCAAGAAGTACATCCCCGGCACCAAGATGGCCTTTGGTGGCTTGAAGAAGGACAA
GGACCGGAATGACCTGATCACGTACGTCATAGCCTGTACCGCAGCCTGCCAGCCTCTTTTGCCTTTACCGCTTCCAGCTA
ACACCTTTCCCAGCTTCCTCAAGGAGTCCACCGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62