GenePrediction:GLEAN_5273 Details

Name: GLEAN_5273
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:778697..777536 (- strand)
Length: 1162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:778697..778675 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_97:778531..778455 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_97:778385..778298 (- strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_97:778231..778138 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_97:778075..777536 (- strand)
Length: 540
>GLEAN_5273 class=GenePrediction position=GCSC_97:778697..777536 (- strand)
ATGCCACATTACCAGTTTGCAATGTAAGTACTTTTTGCCCAGTCCATTTCAGTGTTGGCTATGTTTTGCAGTCCCCGACA
GTGGTCCTGTCGGAGAACTGCCTCGCCGGCACCACACAGGTGGACAAGCAGACTGACAGGTTGTGCCAGTTGTTGTCGCC
ACACAGAAACCAGACGGGCCCTTGGGGAGGCTGTGAGCTCAAGGGGATTCCATTGAGTGGCCACCGGATACTAGGGAACC
TGGGTAGGCTTCCCTCCTGTCCTCGCTTTCACAGCGTCGCATCGGCCATAGTACTGACCTGAGACACCGCAGGCTCTGTC
ATTCTATGCGGTTTCGCCATCTTTGTGTCAGCATTTTTGATATACCGATCAGATCGCAAAAAGGCCGCGGTTGGACGGAG
GTAGGTGACTCCGGGTGTTTCTGTCTCACAGAGTCAAGATGACGCGTGGCTAACATTGTGGAACAGGGAAATGCAGTTAT
TCCTCTTGGGCTATATGTTGGTCGAGTTGTGTGAAATCTTCAGCGTTGGCGAGTTTCCTCTGAACTCCAAAGTTCGCCTT
GTAAGCAAGCACGCTCCACCAAGCCGAACAGCGCCCTGGCAGCACTGACATGGCGGCACCAGGCATTTTCGGGCATGCAC
CTTGGCTTCATCGTGGCGACAATGTGGATATTGATGATAAACGCGCTGGTTGGGTTCCAAATTCTCGATGACGGAACGCC
CCTGTCTCTGGGGCTGATCATTGCATCGGCAGCGATCCTGTTCATTGGGACTGGCTACATTGCGCTCGACACAGGGTTCA
GCTGGACGGGGCACTTCGATTCCTCGCTATCTGGGCACAACCGCAATATCGCGCTCTATGTTCTATACCAACTGGCGCCG
TTGGTTTTTCTCGTTGCATACTACGTGCTGGAGGCATATCTGGTGCTAGCTGTGCTCGGCGAGGCACGACCGCTGATCTA
TCTGACGGCGGCGGCGGTCCTGTTTGCTCTCGGTCAGATATTCAACTACACGATCAGCTCACACATCTGCAACGGCACGT
CGGGAAAGATCGACGGCGCGCTGTTTGAGACGCTGTTCACGTTCCTTGCCGTCGTGGTGTTATGGATATTCTGGTCCAGC
ATTACAGAGGATGACTGGCCAATTACTGCCTCCTATACCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62