GenePrediction:GLEAN_5277 Details

Name: GLEAN_5277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:752677..750759 (- strand)
Length: 1919
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:752677..752653 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_97:752591..752525 (- strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_97:752459..751660 (- strand)
Length: 800
Type: CDS
Source: GLEAN
Position: GCSC_97:751596..750959 (- strand)
Length: 638
Type: CDS
Source: GLEAN
Position: GCSC_97:750851..750759 (- strand)
Length: 93
>GLEAN_5277 class=GenePrediction position=GCSC_97:752677..750759 (- strand)
ATGCAGGCTCCCGTGCTTGTGATGAGTGCGTGCTTCTCTCGAATGCTTGTCACGGCTCCTGCTGACAAACCTTCTCTCTG
CTGCAGACACCCAAGGTGGTGAACGGCAGACTGGGCGCAAGGCCCAGCTGTCCAACATCGCTGCTGCCAAGACGTAAGCC
GACCGCCTGCGGGCACCACTCCATCCCGATGCCGAGCGATGCTGACGGTGGGACATAGTGTTGCCGATATCATTCGGTCG
TGTCTGGGCCCCAAAGCGATGCTCAAGATGCTTCTCGACCCGATGGGTGGCATCGTGCTGACCAACGATGGCCATGCGAT
CCTGCGAGAGATCGAGGTCTCGCACCCGGCAGCCAAGAGCATGATCGAGCTGAGTCGGACACAGGACGAGGAGGTCGGCG
ACGGCACGACGACGGTGATCATCCTAGCGGGCGAGATCTTGGCCCAAGCACTCCCACAACTAGAGCGCAACATTCACCCG
GTGGTGATCATCGCGGCATTCAAGCGGGCGCTCAAGGACGCGCTCGAGATCATCGACGAGATCTCGCTGCCCATCGACAT
CAATGACGACAAGGCCATGCACGGGCTGGTGTCGTCGTCGATCGGGACCAAGTTTGTGTCGCGGTGGTCGGAGCTGATGT
GCGACCTGGCGCTCAAGGCGGTGCGCACGGTCTCGTGGGACGCCGGCAACGGCAAGCAAGAGGTGGACATCAAGCGGTAC
GCGCGGGTGGAGAAGGTGCCGGGAGGCGAGATCGAGGACAGCCGGGTGCTGGACGGCGTGATGCTCAACAAGGACATCAC
GCACCCCAAGATGCGGCGGAAGATTGTCAACCCACGCATCGTGCTGCTGGACTGCCCGCTGGAGTACAAGAAGGGCGAGT
CGCAGACGAACATTGAGGTCACCAAAGAGGAGGACTGGAACCGCATATTGCAGATCGAGGAGGAGCAGGTCAAGTCGATG
TGCGACGCTGTCCTGGCCCTCAACCCGGACCTGGTGATCACGGAGAAGGGCGTTTCCGGTGAGTCTGTGGTGGGCATTGG
GCATTGGGCTTCAGGAGACATGCGCTAACATGACGTCTCAGACCTGGCCCAGCACTACTTTGTCAAGGCCAACGTGACGG
CGCTGCGCCGCGTACGCAAGACGGATAACAATAGGATAGCACGCGCGACGGGAGCGACGATTGTCAACCGGGTGGAGGAC
CTGCAGGAGAGCGACGTGGGAACAAATTGCGGACTCTTTGAGATTGAGAAGATTGGCGACGAGTACTTTACGTTCCTGAC
GCAGTGCAAGACGCCCAAGGCCTGCACGGTGCTGCTGCGGGGGCCGTCCAAAGACGTGCTGAACGAGATTGAGCGGAATC
TGCAGGATGCCATGGGGGTGGCGCGCAACGTCATCTTCCACCCGCGACTGTCGCCGGGCGGTGGTGCGACGGAGATGGCC
GTGTCGGTGCGGTTGGCGCAGCTGGCCAAGAGCATCGAGGGCGTGCAGCAGTGGCCGTACAAGGCGGTGGCGGACGCGCT
TGAGGTGATCCCGCGCACGCTGATCCAGAACGCCGGCAAGAGCCCGGTGCGCGTGCTGACGGACCTGCGGGCGAAGCATG
CCGAGGGCAAGAGCTCGTGGGGCATCAACGGCGACACCGGTGCGCTGGCAGACATGAACGAGTACGGCGTGTGGGAGCCC
GAGGCCATCAAGGTGCAGAGCATCAAGACGGCGATTGAGGTGAGTTTTTTGGGAGGCTTGTTTGGTTGTTTGTATTGTTT
GTATTGTTTGCTTTATTTTCTTTGTCTTTTTTTATCCCACGACTTCTCACAAACTAACATATACAGGCGGCCTGTCTCTT
GCTCAGAGTCGACGACATTTGCAGTGCAAAGAGGGCACAGCCGGGTGTTGGCACGGGAGGAGGTGGTGGAGATGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62