GenePrediction:GLEAN_5278 Details

Name: GLEAN_5278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:749046..747071 (- strand)
Length: 1976
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:749046..748992 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_97:748935..747071 (- strand)
Length: 1865
>GLEAN_5278 class=GenePrediction position=GCSC_97:749046..747071 (- strand)
ATGGCAAAGCCCCGGCTCATCATTGTGGTGCGGCATGCGCAGTCGGAAGGCAACAGTACGCGAACAGGTTCTGGTCCTCT
GTCTGCGGGCGATCTGCTAACGGTGCGCCAGAGAACCGCGACCTGCACCAGACCGTGCCGGACCACCGGGTGCAGCTGAC
GAGCGAGGGCTGGCAGCAGGCGCTGGACGCCGGGCGACGGCTACGGGCGATGCTACGGGCCGACGATACGCTGCAGTTCT
TCACATCACCGTACCGGCGGACGCGCGAGACGACCGAGGGCATCTTGAAGACGCTGACGTCAGACGAGCCGTCGCCGTCG
CCGTTCAAGCGGAACAACATCAAGGTGTACGAGGAACCGCGGCTGCGCGAGCAGGACTTTGGCAACTTCCAGCCGTGCAG
CGCCGAGATGGAGCGCATGTGGCAGGAGCGTGCCGACTACGGCCACTTCTTCTACCGGATTCCCAACGGCGAGAGCGCGG
CCGACGCGTACGACCGCGTGTCCGGCTTCAACGAGAGCCTGTGGCGGCAGTTTGGCGAGGACGACTTTGCCAGCGTCTGC
GTGCTGGTCACCCACGGGCTCATGTCGCGTGTCTTCTTGATGAAATGGTACCACTTCAGCGTCGAGGATTTTGAGGACCT
GCGCAACATCAACCACTGCGAGTTCCTCATCATGCGCAAGCAGGAGGACAGCGGCAAGTTTGCGCTCGAGACGAAGCTGC
GCAAGTGGTCCGAGCTGCGGCGCGAGCGGGCTGCCGCCCTGAAGCAGAAGGAAGACGACGCCGTGCGCGAGGCAGCAGCA
GCGCACGGCAGCAGCAGCAGCAGTCTGGCCATCCGGGACAAGGACGGCCCCCAGCTGGACCGGACCACGCCGGCGTCGCA
GTCGTCCACGTCCATCCAGCCGGAGCGACGCTGGGGCGGCTGTCCGAACGGCTGCAACCACGACAAGAGCTTCAAGATCC
GTTCCGGTCTGGCCGACCTGATCCAGCGCGACGGCACGGCCGTGTATGCCGACGGCGGAGGCAGCATCGCCGCGGCCGTT
GTCGCGGGCACGAGCACGACCGCTGCAGCGGGAGAAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAACAACAAT
AGCAGCGAGCAGTAGCCGAAAGTCGGCCACGGTGACGCCGACGCTGGCGGCGCGACGTTTCCAGGCCGTCGGCTACAGCG
ACGACGACAACGAGGACGAAGGCGCGGACGGCGATGACGACGACGACGGCGACGACGACGACAACAACACGCGCGCCTCG
TCACCCACACAGGTCGCCACGCCAGCCGTCCGCGTGAGCATCGGCGGCAGCGCCGAGACCAAGACCGCCGGCACGGTACC
GCCGCAGATTGACGTGTCGCGGTCGCGCGAGGAGCCCGTGTCGTCGCCCGACGCAACGCCGTCCTTCATCACGCCCGAGG
CACGGCAGCGGTCGATGCCGACGCCCAGCACGGCCAAGGCGCCGGCGCTGCTGCTCGACAAAAGCAGCAGCTGCAACAGC
GGCAAGATGTACCTGCACGTGGGCCGCGACTTTGGCGGCACCTACAGCGGCCACTCGAGCGATGCGGACTCGTCGGCAGA
CGATCAGGTGCACCGACGGACGACGACGACGACAACCAGCAGAGGAGGAGGAGGTGCTGAGGCTCACGACAAGATTGGCA
GTTCTGTCGGGACTGCTTCAGCTTCGGCTTCGGCTTCGGCTTCGACTTCGGCTTTGACTTCGGCTACTGCCATGACTAAG
AATCCCGCTACCGCTCCTGCTGGACACAAAAAGACAATGGCCAATCGGCTGGGCGACGTGCCGCACTGCAGCGACTGCGA
ACACGGCCATGCCGACGACGAGAATCTCGGCTCGGACGAGATGGACGTGGACGATGAGCTGCTAGACGTCAGCCGCGATG
GCGACCTGGCCGAAGCCGAAAAGTTCGACCGCAGCCTGCTGGGGAGCGTGTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62