GenePrediction:GLEAN_5279 Details

Name: GLEAN_5279
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:737238..736089 (- strand)
Length: 1150
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:737238..737142 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_97:737092..736089 (- strand)
Length: 1004
>GLEAN_5279 class=GenePrediction position=GCSC_97:737238..736089 (- strand)
ATGACGGCCGACAGCAGCGACTACGTCCTGGAGGACATCAAGGCCACGCGCATCGCAGCCGACGGCATTGACGCGACCTT
TCGGTCCAACAGCATTGGTAGGTGGTGCGGCTTCTGTACGATGCACGGACGCGGCTGACACGACAGATCTGGTCTCGGCC
GGGCTCGAGGGCCGCGTGCTGGCCTTTTCGGATCAGTGGTTTGCCGAGGCGGCCAACCTGCTGAACCCCAAGGCGCCGGT
AGCCGGCAACGGCCGGATGGTGTATGCGGGCGCATGGTACGACGGCTGGGAGACGCGGCGCCACAACACGGCGCCGTTTG
ACTGGGTGATCATCCGGCTGGGCGTGGCCTCGGGCACGGTGATCGGGGCCGAGATCGACACGGCTTTTTTCAGCGGCAAC
GAGGCGCCGGCCATCTCGGTCGAGGGCTGCTTCCGCGAGGGCGGTGCAGATGCCGATGCTGAAGTCGTCGGCTGGGGTGG
CAGCCGTGGTGGCTGGGAGACCATTCTCGGCCGGCAGCCGTGTGGCCCCAAGCAGCGCCAGGCCTGGCAGCTCGACGTGC
CGCAGCTCGACCGCGCCTACACGCACGTGCGCCTCAACATGTATCCCGACGGTGGGATCGCGCGGTTCCGGCTCTTTGGC
CACGCCCGGCCGGTCTTCCCGGCCGATCCGGCGGCCGTGTTCGACCTCGCGGCCGCTCAGAATGGTGCCGTCGCCGTCGC
CTGCAACAACCAGCACTTTGGCACCAAGGACAACCTGCTGCTGCCCGGCCGTGGTGCCGACATGGCCGACGGCTGGGAGA
CGGCCCGCTCTCGACAGCCCGGCCACGTCGACTGGGCCGTCATCCGCCTCGGCGCTCCTGGCCTCGTCCACCGCTTCGTC
GTCGACACCGCCTTCTTCCGTGGCAACTTCCCCCAAAAGGTCCGTGTCGAGGCTCTACGCTGGACTCCCGGCCCCAACGA
TCCCAGAGAACCTGCCCATGACGACCCGGCCTGGTTCATCGCCGTGCCCGATGCCAAGTGCGGGCCCGACCAGGAGCACG
ACTTCGCCTCCCAGCTGCCGGCCAGCCAGGTCGTCACCCATGTCAAGCTCGTCTTGATCCCGGATGGCGGTGTCAAGCGG
CTGCGCGTCTTCGGCACGAGGGCCATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62