GenePrediction:GLEAN_527 Details

Name: GLEAN_527
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:403552..406020 (+ strand)
Length: 2469
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:403552..403853 (+ strand)
Length: 302
Type: CDS
Source: GLEAN
Position: GCSC_97:404087..404858 (+ strand)
Length: 772
Type: CDS
Source: GLEAN
Position: GCSC_97:404934..405095 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_97:405163..406020 (+ strand)
Length: 858
>GLEAN_527 class=GenePrediction position=GCSC_97:403552..406020 (+ strand)
ATGAGCACACATTTCGCAACATCTACAGCCACCTCTTCATCCGCGTCGTCTCCCAAATTCTTGCCAGGCGACAGACTGCC
CCCACCGCACCACCACGGATACAATGGCCTTTTGCCGCTGCCAGAAGACGCGGCATTCAGCCATGCACTCAAATACTTGA
ATTTTGGCACTCCTCCTGACTCGTACCCTGGCAGCGCGCCTAATGGCACCATCGGGCCCTTTACCATCAGACCTACCATC
CCACATTATGAATCACCCTACGCTAGGAGCAACGCCTCCACAGCGCCCGGGTCGCCGAGAATGTAAGTGGGCTATGCTTG
TCAGCTCTAATCCCCTTGACGGTTTCATTTCGATTTCCATACGATTTTCCTTTATTTTTGCATGTTTGTCTATCTAGCGC
TTTGTTGTTGCTGGGCACTCCAGCCCGGGCTGTGGTCTTGGTCAATCCAGACTGGCCTATGGTAGTGCTTGCTTTGCGCA
CATGCATGAACTCATACGTGATGAAGACTCAACTGACAAGCTACGTCACACATAGCCCTCCACTGAGGCAGAACTCGGGC
AGCCATACTCCGCGCGTTCGACCACATGCAACCTCGCTCAACATCCCGGGCATGACCCGGTCTAAGGTCTCACCTGACGG
ACGAATTCCCGACCGAGATGTCGCTTCCAAGTTGGTGATCATCATGGTTGGACTGCCTGCACGTGGCAAGTCTTACATCA
CCAAGAAGCTACAGCGCTACCTCTCATGGCAACAACACAACACTCGTATCTTCAATGTGGGCCATCGGAGACGTATCGCT
GCCAGCATGGTGCCTGGGTCTTCCGGGTCACAATCTGAGCTGTCCGAAGACCGCCAAGAGGATCCTGACGAGCGACAGTG
TAACGGCCATGCGGATGCACCCTTGCAACAGGCTGCTTCAATTCTTCTGAATGGCATACCGTCGGGTCCAAATGCCGAAC
CTACAACTCTTGATCTCAATATCTCCGAGCAAAGCTCTGACTTGGATGTCTGTCCGACGATTGCTGTCGGTGATGAGGCT
GCGCAGCGCAAACAACAGGCACGAGTGGACCAGACAGCGGAATTTTTTGATCCGAAAAACGAATCTGCTTCTAAGCTGCG
CGAGCAAGTCGCACTCGATACTCTCGACGACCTCCTTGATTACCTACTGCATCATAACGGCGCTGTCGGAATTCTCGATG
CCACCAACAGCACTCTGCATCGCCGCAAGATTCTCGTCGATCGCATCAAGGAGCGTGAACCCAAGCTTGGCATTCTCTTT
GTGGAGAGTATTTGCACAGACCAGAACGTAAGCTCCCATTTCCTCGGCCCGCGTACTATCATCACTAGCACGTCGGATAT
GAATGCTGATACTTTTGGTTAGCTGCTCGAAGCCAACATGCGACTCAAGCTCTCTGGCCCAGACTACAAGAACAAGGACC
CTGCCAAGTCTCTTGAAGATTTCAAAGCCCGGGTCAAGGCTTATGAGAGCGCGTACGAGCCACTTGGCGAGTATGAGGAA
AAACACGACCTCCAGTATATTCAGGTACGTCGAAAGTACAATGCAAGACGTGGCGGGAGGTATCACTCGTGGCTAACCTT
CCTCTCAATAGATTGTTGACGTGGGCCGAAAGATAATCAACCATCGTTTGGCGGGTTTCCTCAGCAGCGGTATTGCCTCT
TACCTCACGACGTTCAACCTCTCCCCAAGACAGATCTGGATCACAAGACACGGGCAGAGCACGGACAATGTGGCCGGCAA
GCTCGGCGGCGATTCTGACCTAACGGAACGTGGCCACTACTATGGTTTGGCGCTGTACAACTTCATCACGGCAAAGCGCA
AGGAGTGGGCAGTGGAGCAGGAAAGTAAGCTTGCGCAGGCCTCTTTCCCACCACAGCCTGGCGACCACACACCTCCGTAC
CCGGAGCTGAATCAAGTCTTTGACGAGAAAAACTTCTGTGTGTGGACGTCGATGCTCAGGCGGAGCGTGGAGACGGCAGA
ATACTTTGATGCAGATGATGACTACGATACAAAGGCTTGGGAGATACTTAACGAGCTCAATGCGGGAACGTTTGAGGGCA
TGACCTACGAGGAAATCGCGCTCAAGCAGCCAGAAGAGTATGCGAAGCGGCGTCGGGACAAGCTGCAATACATCTACCCG
GGCGTTGGCGGAGAAGGCTATTTGCAGGTTATCAACCGGCTCCGCGACATGGTACGGGAGATTGAGCGGGTGACAGACCA
TGTGTTGATCATCAGCCACCGGTCTGTGTGCCGTGTTCTGATGGCATACTTTATGGATCTGACGAGGGACGATATTGCGG
AGCTGGACGTGCCGCTGGGCATGCTGTTTGCCATCCACCCCAAGCCATACGGTATGGAGTTCCACGCCTACCGTTACAAC
GAAGCACAGGGCTGGTTTGATGAGGTGCGCGACTACAAGCCTCAGAAGACACAGGACCAGAACAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62