GenePrediction:GLEAN_5281 Details

Name: GLEAN_5281
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:715217..714195 (- strand)
Length: 1023
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:715217..715109 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_97:715051..714346 (- strand)
Length: 706
Type: CDS
Source: GLEAN
Position: GCSC_97:714273..714195 (- strand)
Length: 79
>GLEAN_5281 class=GenePrediction position=GCSC_97:715217..714195 (- strand)
ATGTCGTCACAGACGAGCGCGGCCGCGCCGGCCACCGTGCACTATCCGTTCTGGTTTGGCGGCAGTGCCAGCAGCCTGGC
GGCGACGGTGACGCATCCGCTGGATCTGGGTGCGGTGTCCCGGCGTGTTGTCCCCGCATCGCGGCTTTCCGGCTAACCGG
CGGCAGTCAAGGTCCGGCTGCAGACGCGTCACGGCGACATGCCGCGGTCCATGTCGGGCACCTTTGCCCACATTGTACGG
CACGAGGGCGTGCGTGGCCTGTACAGCGGCCTGTCTGCGTCGCTGCTGCGTCAGCTGACCTACTCGACCACCCGTTTTGC
CCTGTACGAGGCCATCAAGTCGCGGCTGACCGACGGCCATGCACGCCCGCCCAGCTTTGCCGTCCTCGTGGCTGCGGCCT
CGGTCTCCGGCATGGCTGGCGGCTTTGTCGGCAACGCGGCCGATGTGCTCAACGTGCGCATGCAGCACGATGCCGCTCTG
GCGCCCGCACAACGACGCGGCTACCGTCATGCTCTCGATGGCCTCGTTCGCCTCGCGCGTGAAGAAGGCTTTCGCCACGG
CTGGTTCCGCGGCGTCTGGCCCAACAGCATGCGTGCTGCTGCTATGACCGCCTCTCAGCTCGCCTCCTACGACTCCGCCA
AGCGCCTTTTGCTCGCTACTACCCCCCTCACCGACTCGCTCACCACCCACTTCATCGCCTCCTTCTTCGCCGGCGTCGCC
GCCGCTACCGTCACCAGTCCCATCGATGTCGTCAAGACTCGCGTCATGTCTTCCCACGCTCACCTCACTACCGTCCTGCG
CGACCTCTACGCCGCCGAAGGCCTCCGCTGGATGTTCAAGGGCTGGGTCCCCAGCTTCATCCGCCTCGGACCGTGAGCCC
CCCCCCCCCTTTCTCACTCACCTTGTATGCTCGCCTCCTTCTCTTCCTCTCGCTAACACCACAGTCACACCATCTTCACC
TTTGTCTTTCTCGAAGCACATCGCACTGCCTACCGTCGCCTCAAAGGCATCCCTGACCTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62