GenePrediction:GLEAN_5283 Details

Name: GLEAN_5283
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:701756..699588 (- strand)
Length: 2169
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:701756..701530 (- strand)
Length: 227
Type: CDS
Source: GLEAN
Position: GCSC_97:701472..701000 (- strand)
Length: 473
Type: CDS
Source: GLEAN
Position: GCSC_97:700938..700818 (- strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_97:700761..699588 (- strand)
Length: 1174
>GLEAN_5283 class=GenePrediction position=GCSC_97:701756..699588 (- strand)
ATGCTCCCCAAAGCCTTGATGCTGGCGGCCGCGGCCGGCCTGAGTCTGGCCAGCCCGGTGCGGCGACGGGAGGTGCCGTC
GACACACCAGCTGCATGAGCGCCATGCAGAACACTGGTCGTCGGCGTGGACGAAGCGGTCCAAGGTATCATCGGGCAAGG
TCTTGCCGATGCGGATTGGCCTGACACAGAGCAATCTCGGGGCCGGCCACGACAGGCTGATGGAAATGTACGTCTGGCGG
AATAAGGCCTGAGGAGAGAGGCAGATGATGACTAACCACAACAGCTCCACGCCTGGTTCGGCCCTCTACGGCAAGCACAT
GTCGGCCGAAGAGGTGGCCGACTTTTTTGCGCCGGCGCCGTCGGCCGTCAGCGCGGTCCACGAATGGCTGACGGGCCACG
GCATTGCCGCTGAGCGCATCGGGCAGTCTGCAAACAAGCAGTGGCTGCAGTTCGACGCCACGGTTGAGGAGGCCGAGGAC
CTGCTGCTCGCCGAGTTCTTTATGTGGGAACACACCGAGACGGGTGCTCACGACATCTCGACGGAGGAGTACCACCTGCC
GGAACGTATCCGCGAGCATGTGGACTACGTGACGCCGGGCGTGCGTCTTCGGACGAAGCGGGAGGCCCGCATGCAGGAGG
TGCAGAAGCGCAGCGCGTACGACAACCACCCGCGGCCGGACATTGTGAAGTTGCCGGGTTTCCCGCACCCGAACTCGAGC
ACGTGCTCTCTCTACGTCACCAAGGAGTGCACACAGAGTGAGTGTTTTTGACAAAAATAAAAGTTCTAGGCTAGATGACA
AGCGGCTGACCAAAGCAGACCAGTACAAGATCCCTAACGCCACGTTGGCAGCGGAAGGCAACCAGATCGGCATCTACGAG
AGTCTCGATGTGCACTACAGCCGCGCGGACCTCGACGTCTACTTCAGCCACCTGTACCCGTGAGTGTTTGCGTACCCAAC
GATACAAGCAGGCTCTTTTTGCTCACCACCCACAGACACATCCCGAACGGCACATACCCGGAGGAGCGGTTGATTGACGG
CGCCATCGGGGCGATTGAGGACACGACGGAGTTTGTGCCCAGTGAACTCGAGGCGCCGCTCGACTTTGATTCGGCGTGGC
CGCTGATCTATCCGCAGGGGGCTGTGCTGTTCCAGGACAACGACGAGTACTACGAATCGACCAACGACTACAACGGGTTC
TGGAACACGTTCCTGGACGCGATCGACGGCAGCTACTGCACATACTCGGCGTACGGTGAGACGGGCGACTGCACGGAGGA
GGCATGCCGGGACCCGTCGTACCCCGACCTGAACCCGGGCGGCTACACGGGCCAGCTGCAGTGTGGCGTGTATAAGCCGA
CGAATGTGATCAGCATCAGCTACGGGGCGACGGAGGCACAGCTGCCGGACTACTACCTTAAGCGGCAGTGCAACGAGTGG
ATGAAGCTAGGGCTGCAGGGCACAACCGTGGTCATGTCGAGCGGTGATTCGGGTGTGGGCGGCAAGGTGTGCAACGGGGA
TTCAGGCAAGATCTTCGACCCTAGCTTCGCAGCTACGTGTCCGTACGTGCTGGCCGTCGGCAGTACCGAATGGGACCGTC
AGGCCAACGCGACCGGGAAGGAGCAGCCGTACGAGCCGCTCACTGAGGTGGCCACAGCGCGCTTCGCCAGCGGTGGTGGT
TTCAGCAACGTCTTTGGTATCCCCGATTACCAGCGCGATGCCGTCAGCGCCTACTTTGACCAGGTCGAGAGCAGCCTGCC
GTTCCAGGGTTACCACCACTACGTCTCCGACGGCAACTTCTCTTCCGTCACTGGCGGCCTCTACCACCACGGCGGCCGCG
CCTTTCCCGACGTTGCTGCCGTGGGCGACCGCCAGGTCGTCTACTCCAACGGCTCCTGGTGGTTGGTAGGCGGCACCAGC
CTGGCGGCGCCTGTCTTCGCGGCTGTGCTGAACCTCGTCAACGAGGAGCGCATTGCCGACGGCAAGAGCACGCTCGGCTT
CATCCACCCGATCCTGTACCAGCATCCTGAGGTCTTCACCGACATTACCGTCGGCAGCAACCCTGGCTGCAACACCACCG
GCTTTCCCACGGCCAAGGGCTGGGACCCCGTCACTGGTCTTGGGTCGCCCATCTTCCCGAAGCTTCTAGAGGTGCTGAGC
AGTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62