GenePrediction:GLEAN_5285 Details

Name: GLEAN_5285
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:680705..677206 (- strand)
Length: 3500
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:680705..679922 (- strand)
Length: 784
Type: CDS
Source: GLEAN
Position: GCSC_97:679853..678906 (- strand)
Length: 948
Type: CDS
Source: GLEAN
Position: GCSC_97:678436..677793 (- strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_97:677658..677206 (- strand)
Length: 453
>GLEAN_5285 class=GenePrediction position=GCSC_97:680705..677206 (- strand)
ATGGCTTCAGCTCCGGACCTCCCAGCTGTCCTCCCGTATCAAGATGCAGCGTTCGCTGTTGACGAGCGGGTGGAGGACCT
CCTAAGCCGCATGACCATTCATGAGAAGGCTGGACTACTGTTTCAGGATATGATATCCATAGGTCCCGAGGGCCAGCTCA
TGCCGGATGATCCCGTCGGCAGCAAATTGATGAACCATTTTAATCTTCTCGGTCCTGTGACAGACGTCCGGGAGGCAGCG
GAATGGCACAACCGGCTGCAGCGGCGAGCCAAGGACACGAGGCTCAGCATCCCGGTTACGTTGTCGTCAGATCCGCGGAA
CCACTTTGCGAACAATGTCGGCACAGGTTTCAACGCCGGGGCATTGTCCCAGTGGCCAGAGCCCCTCGGACTGGCTGCGC
TCCGGTCTCCAGAACTTGTCCAGCAATTTGCGACTATAGCCCGTGAGGAGTACCTCGCCCTCGGGATCCGTCTGGCACTA
CATCCGCAGGTCGATCTGGCCACCGAGCCCCGATGGTCGCGCATCAACCGTACGTTTGGCGAAGACGCCGATCTCTCCTG
CGAGCTGGCCAGCGCCTACGTCCGCGGGTTCCAGGGGCCCAAGCTCGGGCCAAAATCTGTGGCGACCATGACGAAGCACT
TTCCCGGCGGCGGCCCGCAAAAAGACGGTGAAGATCCTCACTTTGCCTATGGCAAAGAGCAGATTTACCCTGGAAAGAAT
CTAGACTATCACCTCCGTCCCTTCAAGGCCGCCATCGCAGCTGGAACCACTCAGATCATGCCCTGTAAGAAATTTCCAGG
CCTAGTTTAGAGAGAGAAACAGATGTCCCGGCCGAGCTGACAGTTGATGTAGATTACGGTAAGCCCATTGGAACCAAATA
CGAGGCTGTCGGGTTTTCTTTCAGCAAAGGGATCATCACGGACCTGTTGCGTCAGGAGCTGGGCTTCTCCGGAATTGTCT
GCACGGATTGGGGCCTCGTCACCGACGCGATCATTTCAGGACAGGACATGCCCGCACGTGCCTGGGGTGTCGAACACCTC
ACCGAGATAGAACGGGTACAGAAAATCATCGACGCGGGGTGCGATCAGCTCGGTGGCGAGTCACGTCCTGAACTGGTCGT
CCAACTGGTTGAGCAGGGCCTGGTTTCTGAGGCTAGGATCGATATCTCCGTTCGTCGGCTCTTGCGCGAGAAGTTTGTAC
TCGGGCTGTTTGATCAGCCCTTTGTGGACGCGGAGGTAGCCGTTCAAACGGTGGGAAGGGCCAATTTTGTGCGGCAGGGC
TTAAATGCCCAAAAGCGTTCTTTCACCCTCTTGACGAACAGCAAGGACATCCTGCCGCTTCGTAGAGGGAACCTGAAAGT
CTATCTGGAAGGCCTATCCCATGCTACGGCCACGGCCCGTGGACTGTATGTCGTCTCGGATCCAGCTCGTGCGGACATTG
CGCTACTCCGGCTGAGCACGCCGCATGAAGCACGTCCGGGAGGCTTTGAGAAGCGCTTTCACAGCGGGTCTCTGGCATTT
TCTTTTCAGGAACAGGCCCGACAGGCAGCCATATATCAGGCGGTGCCCACCATCGTCGACGTGTATCTCGATCGGCCCGC
GGTTATCCCGGAAGTTGTGTCATCGGCCGCGGCGGTGCTGGCGAGCTATGGGAGCAGTGACGAGGCCCTGCTTGATGTAG
TGTTCGGCGAGGCAGCCCCCGAAGGCAAACTTCCGTTTGACCTCCCATCGTCCATGAAAGCCGTGGAAGAGTCTCTGACC
GATGTCCCATACAGCTCAGAAAGCCCCATATTTCGGCTTGGTCATGGCTTACGGTACACACATTGAACTGGAGAACGCTG
ATGTGCTTGCCCCTGGGCTTTTGGCCTTGATTTTGCTTTCGGAAGCGGCCCTGTAGATCGTATTTAGTTAGCTTTCAAGA
AGTTCAACAACTGCCATACTTTACATCTGACGGAAACCCTACTTTTGATCACAGTCTGAACCAGGAAAGCTATCAAAGCA
ACACTTTACGCTGATAATATGATTAACGTGGCAGCAAGGCGGCCTCATTCACGGAGTGATCGCAGGCAGTGTGCCCCGAT
GGCGATACGTCGCTTAGTCATCCAACGTGATCTCCTATCGTCAGAACTACGGCCCAGAGCCATACGGACGGAATATGAGA
TTGTCCCGAAGGTCCCCTATCAAAAGAGGTGTAAGGGATAATTCTTCGCAGGTAAGCAGAGGCAGGCAGGCATAGCCGCG
TAGGCCAAATTGTCTCGACGTTTACAAAGCATACGATCGGTCACTTCCCCTCGCCGACTTAGACATTGCACTCAGCACTC
CACACTCTGCATTTTCCCACACCCGCAGCCATTCACTCCAGGTCGGAACGAGGTGCCCCGAAAATGGCGTCAACGACAGG
CCTGCCGCCACCGACGATGCGCGCATGGCTGCGGACAGGTCGCGGTGCAGCGAGCCACGTGCTGGAGCTGGTGGACGGCC
TTCCGACACCGGCCGTACCAACAAACCGGTCGTCGGCCGACGTGCTGATCCGGGTGGCGTACGTGCCGCTGCAGTTCAAC
TCGGAGCTGCTGCTGCAAATGGTGCCGAGCAGCCTGGCGTTCCTGACGGGACCTCGTTACATCCCGGAACTGGAGCTCTC
GGGCGAGGTGGTCGCGGCGCGTTGGCCGAGTACGTGCGGCTGCCGGCCAGCCAGGTAACTCAAATCGATGACGCTGTCGG
CCTCGAGGACGCCGCGGGACTGCACTGCTGCGGCTGCACTGCCCTCAAGATGATTCGCACGGCCAGCCTGTGCGCCGGCC
AAACGGTGCTCGTCAACGGCGCCAGCGGATCCGTCGGCTCGGTGCTGGTACAGCTGTGCAAGCTGCACGGAGCTAGCGTC
GAGGCTGTGGCCAGCGGGGGCAACGAGGCCATGGTGCGCGGCCTGGGGGCAGATGAGGTGAGGGAGAGAGACGGAAAGAG
AAAGAGAGCGAGAAAGATGGCGAAAAAAAGGAGAAAAGAAGGAAAAAAGAAGGGAGAAAACAGGAAAAAAAATAAGAATG
ACTACAGCTGACATCCCAGTTCATCGACTATCACCAGCACAATCCCCTTCCGGCCTACCTGGCTCAGAACTACGGTGACC
GTCCGTTCGACTTTCTGTTTGATTGCGTCGGCTCGCAGCCGCTCTTCGACCACTCGCCGGCGTACCTTCAAGCCGACGGA
GCCCTGATCAACGTCAGTGGTGCCAACGCCAGCAGCGTCAACGGCTGGCTGGCCACAGTCCGCAACGTGCCGCTCAACAC
CTGTCTTCCAACCTGGATGGGCGGCGTACCACGCCGCTACGCCATATTCAGCACGCCGCCAGCCCACGACGACGGCGTCT
ACCTAGCCCACCTGCTCGAGGCCGGCAGCGTGCGCATCCCTGTCGACTCCGTCTTCGCCTTGCCGGACGCCCTGCACGCC
TATGAGCGTGTCGCCACCAAGCATGAGTGGCTGTTGTGCAGAGAGGAGGCTAAGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62