GenePrediction:GLEAN_5286 Details

Name: GLEAN_5286
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:677134..675954 (- strand)
Length: 1181
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:677134..677129 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_97:676957..676394 (- strand)
Length: 564
Type: CDS
Source: GLEAN
Position: GCSC_97:676265..675954 (- strand)
Length: 312
>GLEAN_5286 class=GenePrediction position=GCSC_97:677134..675954 (- strand)
ATGGTCGTTCCTTGTTACAGTAAAACGCTCCCAAAAATGCAGCATACGTCGTCAAAAGCCATATGTGGTGGGACGCCATA
ATTGGTGCCTGGAAACTGAGGGGCCAAAAAGCCAATTGAAGTGGGTCCAAACTTCTCGCATCACCATATTTTTTCCCATA
TCTGGACGACATCGCAGACTGTCCCGCAGCAGACCCAACGCGGAACGACGCCCGACAATCTCCACGCCACCGGCCGCGTG
CAGCTCTCGTTCTCCTTTGCTATCCTTGCTCCCGAGCCTCTCCGTCCGATGGCAGCACACAACGCCTGGGCGGCCTCCGG
GCTCCTCCGAGCCGTCCAGCGTCTCACGATCGCCCCGAAGACGGCATCGACAGCAGCAGCGGCATTTGCTGCGGCACCGT
CCATGTTCTCGCTGACGCTGCCGATGTCCCCCCTCGCCGTGGCCGGCCGCCGCGCCTTCTCAGCCACGGCTGTCGCCGCC
GGCACCTGGCTTGAGCCCAGTCTCAACCGCAAGCGCCGCATGATGAAGGGCCGTCCGCGTGTGGCCACGGGCGGCTCCGT
CAAGGGCACCACCATCGTGTGGGGCGACTACGGCCTTCGCATGTGCGACCACCACCGACGCATCAGCGCGGCCCAGCTCA
AGGTGGCCGAGGACACCATCAAGCAGCGGCTGCGCGGACAGCGGTACCGCCTGTACAAGCGGGTCAACTGCAACATTGGC
GTGTTCATCAGCGGAAACGAGGTGCGTGAAGACGGGGAAGAGGACTAGCAGAAAAGAAGGCTTGATGTTTTGCCAATTCT
ATCTTTCTCCTTGCCCTTGTTCTTTGTCTTTTATCTCCTTTCCTCCTCAGACACTGACAAGTCCCTTAGATACGAATGGG
CAAGGGCAAGGGTTCGTTCGACCATTGGGCCTCCCGTGTGGCCGTCAACCGCGTCATCTTTGAGATCCGCGGCGCCATCC
ACGAACAGGTTGCACGGGACGCCTTCCGGCTCGCCGGAAACAAGATGCCCGGCCAGTACGAGTTCGTCAAGAAGGGCGAC
CCTCCCATTGTCGGCATCACCAAGCTCGAGGACGGCCTGACCCTGGAGGACCTCAAGCGTCCATGGCAGCTACCCGCCGC
CCAGCAAGTAAAGATCGCAGAAGCGGCAGCCACATCCAATTCCACGACACCAGCCCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62