GenePrediction:GLEAN_5287 Details

Name: GLEAN_5287
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:675134..673961 (- strand)
Length: 1174
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:675134..675048 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_97:674985..674363 (- strand)
Length: 623
Type: CDS
Source: GLEAN
Position: GCSC_97:674309..673961 (- strand)
Length: 349
>GLEAN_5287 class=GenePrediction position=GCSC_97:675134..673961 (- strand)
ATGGCGCTGATTGTCGACAAGCACCGGCCGCGGTCTCTGGACACGCTGACGTATCACCCAGAGCTGACAGACCGACTACG
AGCACTTGTACGTGAGATCGACTCGAGGGATGGTAGAGGGACTCTTCCGTGCTAATCCTCCCATGACAGGCTCGCAGCGG
CGACTTCCCACATCTGCTGGTGTACGGGCCATCGGGAGCGGGCAAGAAGACAAGAATCGTGGCGACGCTGAAGGAGCTGT
ACGGGCCGGGCGTGGAGAAGATCAAGATTGACGCGCGCGTGTTCCAGACGACGAGCAACCGGAAGCTCGAGTTCAACATC
GTGGCTTCGGTCTACCATATGGAGATCACGCCGTCGGACGTGGGCAACTACGACCGCGTGGTAGTGCAGGACCTGCTCAA
GGAGGTGGCGCAGACACAGCAAGTCGACCAGGCTGCCCGGCAACGCTTCAAAGTCGTGGTGATCAACGAGGCCGACCACC
TGACACGCGACGCCCAGGCAGCCCTGCGCCGCACGATGGAAAAGTACTCGCCCAATCTGCGGCTCATCTTGCTGGCCACG
TCGACGGCCAACATCATCGCGCCCATCCGGTCGCGCACGCTGCTGGTGCGCGTGGCCGCGCCCTCGCACGACGAGATCTG
CGGCGTCCTGGCAGCCGCGGCGCAGCGGGAGGGCTGGCCGGCTGTGCCGGCGCTACAGCGCCGTGTCGCCGAGGGCAGCG
GGCGGAACCTGCGGCGGGCGCTGCTGATGTACGAGGCCGTGCACGCACAAAAGTAGGCATATTTCCCTGGTCTCCTTCTC
GTCTCTCTCGTGCTAACGGTCGCAGCGAGAAGGTAGTAGACAGCACGCCCATCCCGCCACCCGACTGGGAAGCCCTCATC
GGCCACGTCGCCAAGGAGATCATGGACGAGCACACACCGGCACGCATCCTGCAGGTGCGGGCGAAGCTGTACGATCTCCT
GACACACTGCATCCCGCCGACGACAATTCTGCGGACGTTGACGTTCAAGCTGGTGGCGCTGATCGACGCCGAGTTGAAAC
CGGAGGTGATCCGATGGTCGGCCTTTTACGAGCACCGCATCAAGACGGGTACCAAGGTGATCTTCCACCTGGAGGCGTTC
GTGGCCAAGTTTATGCGGATATTCGAAATGTACCTCATGAGCATGGACATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62