GenePrediction:GLEAN_5288 Details

Name: GLEAN_5288
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:672352..671387 (- strand)
Length: 966
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:672352..672125 (- strand)
Length: 228
Type: CDS
Source: GLEAN
Position: GCSC_97:671941..671387 (- strand)
Length: 555
>GLEAN_5288 class=GenePrediction position=GCSC_97:672352..671387 (- strand)
ATGCGGGGTCCTGTCAGCCAGAGGTCGGGAGGCAGGACGAGACCTGAAGGCGGTGCGACGAGCGTTTGCCTCACCGGACG
TCCTGGACGACCGCGTCCCATTGCATCCGATGCTGTGAGATCGCACATGGCGCTGCGTCGTGGCGGCTGGTGGGCGGCCA
AGAGTGGCAATGACGATTCCTCGAGCATGCTAAAAACATCGCCAAGATGCCCGCTGTACATAGTAGAAGTAAATGCGCCT
CGTTCAAGAGAAGGAGGGCAGTCGTGCCTTCCCGTAATAGTCGTGCTCGCCATGCATCTCGTCCTGGTACTATGCGCACT
GCCGGAGAGAGAAGGTGCCAGCCCGCTGTGGCCCACCTACAACAGAACGATCTCGGGCATCATTTTCTGACGTCTCTTTT
TCTCCCAACAGGCACGACGAAACTGCTCGAGGAACGGTCGTTGTCGAGACACAACTCCGCCTCGTCCCCAGCATCAGGTT
TCCTCCACGGCTCCCGCAGCCACGGACGTCCAGGACCAGCTCCACATCCAGCTGGACGGCAGAGTGGGACAAGCACGCCC
CGAGACGACGTCGGACGGACGGAATCGAATGGCACTGGTCCTTGGCCCAGACCAGGACGGATCCGCTCAGGATTGTCGCT
CGTCCAGGTACTCTTGTCTCTGCAAGTACTATGGAAGATACGAGGACGAGCTGCGTCACAAGCCTAGCACGCACACCCAG
AGCTTCCTCCTGACCTCACCCCCTCCCTCGCCCAGACACCCCCGGCTTCGTCTTTGTGCTCTATTGGCCTCTTCTCCCTT
CCGTCCACCCATATCCCACGCCCAGGTCATCGCCACCCTCCGCAGTTTGTCTGCAATCGTCCTAGGGCTGCCACCCGTTT
CCTTTTCTTCCCCTACTCCGTTCCCCTCGAATCTGCTCTGTGAGGTTCCCCATACACCCCTCCCCGCGTGCACTGGTGCA
CACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62