GenePrediction:GLEAN_5289 Details

Name: GLEAN_5289
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:670856..668271 (- strand)
Length: 2586
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:670856..670793 (- strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_97:670710..670687 (- strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_97:670640..670488 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_97:670457..670431 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_97:670368..669206 (- strand)
Length: 1163
Type: CDS
Source: GLEAN
Position: GCSC_97:669132..668872 (- strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_97:668803..668399 (- strand)
Length: 405
Type: CDS
Source: GLEAN
Position: GCSC_97:668333..668271 (- strand)
Length: 63
>GLEAN_5289 class=GenePrediction position=GCSC_97:670856..668271 (- strand)
ATGGCTGCGTCGGCGCCCAAGAAGATTCCCGTGGTAGCCGAGGCCCACGAGGTCGATACCTTTCGTGAGCTCACATTTTT
TTTTTTTTTTTTTGTTGGGGCAAAATAGGGGAGACATTGGGAAAGCCACTAACCAGCCGTTGACAGACCCACCGGAGAAG
ATGCTGGCTAGTACGTAAAGTCTCAGAATCACACAAGATTCCCTTCTGTCTGGTAGCTCGAAAGGGTCGTGGGAGTCTCA
GGTCGTCCTATGAAGCTGGCCGAGGGCCTGGCAAGGCGTCGTCGTGGTCCTGTCTTGCGTCGTCCGGAGAATGGACGGCG
GCGAAGTTGGGCCATGCGGCGAAGACTGGGACTCCGGAGTCGGACATTGGTAAAGAACGTTAGCTAATTGGCTCGACAGA
GCACCCGTCAAAGCCTCATCTTTCCGGTAAGTCGTCTCCGCCACGGCCATCTATGCGCCCCTGTTCTTCATTGCTGATGA
CCGGCCAGGTCTCGATGAGTACAAGACGCTGTACGAGGAGTCGATCCGACAGCCAGACCAGTTTTGGGGCCGCCAGGCAC
GCGAGCTGCTCACGTGGCAGCGGGACTTCCAGACGGTGCGCAGCGGCTCTCTCGTCAACGGCGACGTCGCCTGGTTCCTC
GAGGGCCAGCTGAACGCGTCGTACAATCTGGTGGATCGCCACGCCTTCAAGGACCCCGACCGGGTGGCGCTCATCTACGA
GGCAGACGAGCCGTCGGACGGGCGGACGCTGACGTATGGCGAGCTGCTGCGCGAGGTATCCAAGACGGCCTACGTGCTGA
AGCAGTTCGGCGTCAAAAAAGGCGACACCGTGGCCATCTACCTTCCCATGATCCCGGAGGCCGTCATCGCCCTCCTCGCG
TGCAGCCGCATCGGAGCGGTGCACTCGGTCGTCTTTGCCGGCTTCTCGTCCGACTCGCTGCGTGACCGCGTGCTCGACGC
CAAGAGCAAGGTCGTCATCACCTCGGACGAGGGCAAGCGCGGCGGCAAGCTCATCGGCACCAAGAAGATTGTGGACGATG
CGCTGAAGCAGTGCCCCGATGTCAGCCACGTGCTGGTGTACAAGCGCACGGGTGCCGACGTGCCCTGGACCGAGGGCCGG
GACTTCTGGTGGCACGAGGAGGTGTCAAAGTGGCCCTCGTACATTGCCCCGGAGCCCGTCAACTCGGAGGATCCGCTCTT
CCTTCTGTACACCTCCGGTTCGACCGGCAAGCCTAAGGGCGTCCTGCACACCACCGGCGGCTATCTCGTCGGTGCGGCAG
CTACGGGCAAGTACGTCTTTGACATCCACCCGGGCGACCGCTACTTCTGTGGTGGCGATGTGGGCTGGATCACGGGCCAC
ACGTATGTCGTGTATGCGCCGCTGTTGTTGGGCGTGACCACGGTCGTGTTTGAGGGCACGCCGGCGTACCCGAATTTCTC
GCGCTACTGGGACATTATCGAGAAGCACAAGGTCACCCAGTTCTACGTCGCACCCACGGCTCTGCGGCTGCTGAAGCGCG
CCGGTGACCAGTTTGTTAAGCACGACATGAGTGCGCTGCGTGTGCTGGGATCGGTCGGCGAGCCCATCGCTGCCGAGGTC
TGGAAGTGGTACTTTGAGGTGGTCGGCAATGAGGAGGCACAGGTTGTGGACGTGAGTATTGCTTGTCCTTCTCAGTCTTT
TCAGTCTTTGCCAGTCGTGCCGTAATGATCGCTGACCTTGACAGACATACTGGCAAACGGAGACCGGCTCCAACGTCATC
ACGCCTCTGGCCGGTGTTACGCCGACAAAGCCAGGCTCAGCTTCTCTGCCGTTCTTCGGCATTGAGCCGGCCATCATCGA
CCCAGTCAGCGGCGTCGAGATCACCGGCAACGATGTCGAGGGCGTGCTTGCGTTCAAGCAGCCGTGGCCCAGCATGGCCC
GCACCGTTTGGGGCTCGCACAAGCGGTATATGGAGACGTACATGGATGTCTACAAGGGCTACTACGTGAGTTGAACTGCG
CCCTTCTTTGTTGCTTTTTGCTCGGAGCCAGACGGCTGACTTGATAACTGCAGTTCACGGGCGATGGTGCTGGCCGCGAT
CACGAGGGCTTCTACTGGATCCGGGGTCGCGTGGACGACGTTGTCAACGTCAGCGGACACCGTCTGTCGACGGCGGAGAT
CGAGGCGGCCCTGATCGAGCACCCGGCCGTGGCCGAGTCGGCTGTGGTCGGCGTGCACGACGAGCTGACAGGTCAGGCTG
TCAATGCATTCGTCTCGCTGAAGAGCGGCAACGAGGTCACAGATGCTCTTCGCAAGGAGCTTGCCCTGCAGGTCCGCAAG
AGCATCGGCCCGTTTGCCGCACCCAAGGCGATCTATGTTGTGCCTGACCTTCCCAAGACGCGGTCGGGCAAGATTATGCG
CCGTATTCTGCGCAAGATCCTTGCCGGCGAGGAGGATCAGTTGGGTGATATCTCCACGGTAAGTCCTGCTTCTGCTACCT
ATCTACACCTTTCTGCATGCCAATTGTACTGACTGAATACCAGTTGTCCGACCCGAGCGTGGTGAGCAAGATCCTCAATG
TTGTGCACGATGCGAAGAAGAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62